Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs924 ]


Position: chr17:2,081,998-2,084,289 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: SMG6(intragenic)

Timepoints:
e11.5

Reproducible staining in unidentified abdominal structure anterior of hindlimb.

Expression Pattern
other (5 out of 13 embryos) 

Embryo 3

Embryo 4

Embryo 6

Embryo 7

Embryo 8

Fasta sequence
GCCACCCTCATATGTATAGCCtctgtcatatcactatggtgtgctaaacccatcagcact
gtatgtttgggaaagagcagcccctaggggatcctgacatctccacggcatgagtggagc
cctcggcggcctccctggtgcggattctcacggttcctgcctctccaaacttttagctgt
aaccactccaacacgtcttcttagcttagcacacactggacccaaataacctcagctcag
agctggaaagtactctccctggggtcagctgctgtaccctgctggggtcagactggagcc
ttaggccaacaccccttcctctcacaaggagtcctacgggaggcgtggggaggggacagg
ggctcctgccgtgggagagatcacgtgtgccccacactcagcacttggaggaagaggaac
cccctggtgccaggctgcagtgctaacgccccaacccggagccagggagactgggtgggg
agccagggtagcaaaggggcttcccacagccaccaccacttccttcagggaagtgctgat
ggactattactcagtgacctcctaaaatgcccttttgggaaggcatattaagtgtccttg
aaggggtgccgattagccttgggattagttcttatttcagagctgccctatgaaggtgag
tgaactagttgttttttaacttgagaatttctatctcatctacagagtcaacacatggaa
gctccctaaggaagtcagcttactgcatacgccctacgtatccctctttctccctatgtg
acaagacctcagagggctccctacgacccttctccagtgtgctctgtagactatggaaga
cgatccatggaaaagcagcaagtacaagaatttctagagtttttttttttttaaacagta
ctccaatccaacagtgtgataaatgcatccgagctacaattaggaagatatatagcatca
gaatgcgaaggtctgggcagcctggtgaaacgcgggctctccagagccccagctatgttt
cccattatgtaaccctggtcatgggcagacagccagactccaaatgaaaaagagactctg
gcttggcactggttctattttcctatcctcattcggggtcagcgcagtgtcatacagctg
cagagaaagctctggggattaaacctgggaaagcctccaagaccaggacctgggttcaag
taccagctgaaagcaataaaccaactgccacagctgggctaggtttggatgttctcaaag
tcccctgactctttcacttactgagaactagaaatcaggataagtgaagatttggcctca
gcagagactgaaatgaggtaggctgtcccactgccctagccttgccaaaggtcctgggat
gcaaggggtcactatgctcaggtccatgaagcctgtcgctctactcctctccagcacgac
tttccttgtgctcacttgccgaagtaggggtgcagctgcctctcccttctcaccagaggc
ttggtgtggatgggaacacaaactatgctagcagatggggcaagtaggtgggccctccaa
accaagcagtctgtcctaaacacacccagcactctacattgactttcacagtggccccag
gccactttccacatcctgctataatcctctataccaataatctcctgggattatgaagcc
attctgttacaatccctaacgggtacaactggggagtcaacttgcttccatccatgctgg
ctctaacacacagatctaataagtgccacagcgagggaaggcacacatgcccacatgccc
agcaatcctgccctcatcactctgcagtgccaacgatactctcatcatcatcctaggtgt
tccacatgtgcctgctgttgtggttttgactggaaggaagaggagcatgggcaaagagga
gagaaccaaggaaactcaagatgaaccctggaattcccctcagagaggggaagatgctgt
gcaatgattctctaactgcataaggaaagagggtaacaaattaaagacagggagggaatg
aaggaagagagatgaaagaagggtcccacatgtcagagggaccatttggaagtggggttt
ctggaggaaaagcaaaggagacttcctctttgtaggaaaaacaggctctctggtcacctt
atcttaggatcagagaaatgtatctttgcaaagaagaaactcaggcaaagaccaatgaaa
gcatgccaagaaggggcactaaacagcagccatttcattcctgctcccttggGAGCATTT
CCAAACCCTTCA
Primer
(+)GCCACCCTCATATGTATAGCC
(+)TGAAGGGTTTGGAAATGCTC


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.