Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Mouse element [ mm921 ]


Position: chr5:112,104,093-112,105,425 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: C130026L21Rik - E130006D01Rik

Timepoints:
e11.5
e14.5

Reproducible staining in shoulder region. Additional information about this enhancer, including optical projection tomography (OPT) data of embryo #1, can be found at www.facebase.org

Expression Pattern
facial mesenchyme (6 out of 6 embryos) 
other (6 out of 6 embryos) 

Embryo 1


Embryo 2


Embryo 4


Fasta sequence
ttCtTATGGGAGCTTTGATCTTGTcacctgcagaagtcataaaagttgctcagcaaggtt
ccctatgatgtggctcccctgtcccccgtcagtacaggcctgtgcagtacagctgttgga
gaaagacattgatagtggttctgcctcagagaatgagccacagagtggtagcaagcagaa
ggtagaaaggggatgtcatgaggcttagcgggtggccataccaccctgcattccctcagt
gcaaggacctctggctctgcagcagccaatcggggcctcttgacccgtggtgttcagagc
agtggggacagctgggactcatggggccagtgggggaggctggccagagttggagaaccc
cagaaaggcagccagcaaccatccagggatggagtgccaaggaatggtaaagagccctgg
gagctacctggccctatgacccacttctggggttattccatgtaaggtaaacctggtggc
aatgaccctgtggcaggcagaaccctagctctccaggctccagccctctggcctctcctc
atgttttctgtctggccagccatgcctggccgagctgggggaacacaggccccttcagaa
gcacctcccacccccagtctggggaccagcagagccttgacaggctctggagggaagcgg
gtcccaggcccagctgtgtaaatgttttcggttttcctgctgagcctcgggcttgagtct
gtgccaagacaagcctggccgcagttttctttggcaagggtgaggcttgggaatgtcggg
gaactttccaagagggatggtgtgtctcaggccctggggtgtctgggtgtactgtgccat
ccctgagtgttgtatccctgttagattcccgagccaaggctgcctggtgggaggggggct
gctctctcgcagtgaccccttcctccaaggaacagtaaggggtggctggaggctccaggc
agttcctccagttgccatggtgtggtgctgctgctgatgttgccggtggtggtggttacc
agagtccagaagagcttgcaggagaggtgtggactctcactggacctactctgggaaaca
cacccatctaaccatggtggggttcttgctttggcttgggtccttttggctggctgtgac
atcagagccttctggctggatctcacaggagggaaagtctggagggagggctcaaatggc
aatggctacttccaggattggaactgcctaggagtgaggcaacatggaagggtggggact
gcaacaggcagggagatggagtttgagctggttcagcagggcaaagtatcttgGTTCTAG
CTGACAGTGGCTC
Primer
(+)caccTATGGGAGCTTTGATCTTGT
(+)GAGCCACTGTCAGCTAGAAC


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.