Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs921 ]


Position: chr2:236,962,599-236,964,857 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: AGAP1 - GBX2

Timepoints:
e11.5

Expression Pattern
branchial arch (5 out of 7 embryos) 
forebrain (6 out of 7 embryos) 
limb (4 out of 7 embryos) 

Embryo 2



 
Sections available
Sections available
Embryo 3

Embryo 4


Embryo 5



Embryo 6


Fasta sequence
TCACCTCTGTGCCTAAACTCCcttcttgtctttaacctataaaaagatgtcgccttcgat
aggaagatttggggccagacatcagaaatccacgtgggagagactggccgtacacttcca
gatggaacaagtctgcccagtgatgtgagttccatctctttttgattctggaactccact
ttcatcttatttatgcacatggagatattgataaaggggaaatgtatccaaactgaaaat
aattggatccctacagctaactctgagatattaaaagcagtaccacttggctgtgtcttt
gtcttgttaggtttgatcataagatcacaatgtagtaatctcgggctcaaatttctggca
taaagatgcactgttccaaatgtggcctcagggaacacgactgcccacacagccccagga
ttgtctcatcttattatttttcaacagttcttggcctgctgaggtcaatgttttgtctct
tttgagtgttcctctatgcttgacaccttttcctattttctttcttaaaaaaaaaaaaaa
aaaaagggagggggagaaaggagaaaaaaaataaaaaaaggactttgccgcgatgaccag
agtccatctgcagttgggtggcatctgctccccacatgtcactttcctcattaacaagca
attgaattaattaaatgctactcagaacacgcataacaagctaccggcagtgtccaaatt
agcactgataatcaaggatgatttcctttattatcctgctaagtggtgtgcagactctga
tctccctgtctgccctcatctatttacatacccccagctcctgcctttggaagcggaggt
tatcttacctagttaatttgccacgatcaccgagcatggcggattgatgccctgcccctg
ccgccactgccgggcccgggccccctccccggctgccctcccccagccccagcctttgta
tctcaagctcactgataaattaaaggccacccctgtggtctctcaagtgagtaatagagg
cagaaatttcattttgcaactggctgatttaatgatccaaagggtaattaatggcctgat
tatcttaatgttaaatatgtccggcagcaattactgtgacctcccgcttgtcaaggtccg
ggctgtgctcttctttcaattaagttctctggggcttaatggtatgaataaactcctctg
attctatcatcccggatgcagagggttcagggagctgggggctcgtttggagttttaatc
agcctgtcttctactccggcgatcagagttaacaattatagcaaggacagtttaactttc
ttcttcgccgtgcagacccccctacatgtacacacatgcacacttttgtgtgtggcttta
tgtgccttgttttcatgtgtttctttcagtgctctcagggagaattctgtttgtggagga
agctgctgtgctctgtgagcctcgtctcttccaatataaattatcatgtgaacgctgtgg
tttttctatttgacaggcttaattaattggcaggagcccccgaaaatgacagtaccacta
attgcaactcaaagtgaatttctgtcaccgcggcgtgcttgtcagtgggcctgccctggc
cccagccgcagagcgggtccaccctcccagtttccccgtccaggcagggactgtgccctg
ctcaagccacgacagtggcagccttctccgaggagccgtgggtttgcaggcacaccgtct
gctggcaggagtgacatttactaccaataaagtttatacatcctcggctatgcaaacgca
acagctgctcagggacctcagcccttacttaagatattttagcaacttctcttagcaagc
caacttggaatcagactgagagaaccataactcacttagccacccttcatgactggatgg
tcctcattagcacactgctaaatatgcttcagtttactagagctcagggcccggatcaga
aatattctgctataaatattaagccaattaggaaaatgtacaaatgagaagtacgttaac
actgcctttaaaataatacctacagattacagttgacaacagatagagcaatgcatctag
tgaacctccaccagggagcttggtgggaatccaggcaagctctccataaagactggctct
aattataagaaaggtgattctaagaagattctccatgaggttaagtataatgggatctgc
tttttcaaggataactataCTTGCATTTGCCTTTGAACC
Primer
(+)TCACCTCTGTGCCTAAACTCC
(+)GGTTCAAAGGCAAATGCAAG


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.