Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs909 ]


Position: chr8:100,680,409-100,681,809 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: MIR875 - COX6C

Timepoints:
e11.5

Expression Pattern
dorsal root ganglion (5 out of 10 embryos) 
other (8 out of 10 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 6


Fasta sequence
GTAACAATGAAAGTTATGACCCTGAattaaccaggcatggtgatatgtgcctgtagtcct
tgctactcagagagccgaggtgggaggattgcttgagcccatgaggtcaaggctgaagtg
agctatgatcatgctactgcactccagtttgggcaacagagtaagaccctgtctcaaaaa
aaaaaaaaaaaagttgcaacccttaaaggtagagggaatactgattataactgcctaacc
ttaagctttcttcaaaaagatgtaaacttcacagcttttgaaatttagccttttagatgt
attttgcagggattattttctctaaacaaggtgatacaaatgctgctctttagcatttgt
ttttagaaaaataatgtagagttcttgagtattcccctatttcttctgttcacctaatgg
taccttaatagagcaaatggtaggtcccaacttctacatcaaaaactctttcaaagctct
cccaaccccccaccttttccccttgtacccattagcaaggtcagtggcttggagaaacct
ggaaaacagcagctaccagaaacccactagaataatatctccagcaggtgatagattagt
tggaacaaattggaaccattgcagttcggcaatcctggtttctttcaagctgtttttaaa
atgtcgtcattttaatacacaatctaaaccctgcggaacagtccacagcaggttaatttg
aatcatatgatgtgtcactgccctcagctgacatgagctctattccatgtgtgaagccat
aataaatccattcccaaccaaggaaaattccccgtgagaaggtgaactaatccaggcctc
acactggcatgctagccctccataattgaaagcagggccacctgttcccagcacagttag
cctatagaaaaaaattagcattagatcagatacgtcttatattgaaaaatcaatcatact
tcttgcaaattcaaattcatctgtgaagtgtttggtatgacatcatacagaaatgtagga
atgtgcccacttgatcccattttaaaagtttttttaaccataggattccttaactttgaa
atgcaatttttttttaatttaatgagagctgacacatgagaagaagaactggaaatggtg
cagatttttctaattaactcagggttatttgcaaaaacatttgagctctctggtattttt
ttcattgttctttcacgaatttttgagccactgtcattgtagccatgaaatgacatttaa
atgacaacaaagaacaaaaatgccacattgggaaaacattcccaagtcatttatgtttta
ttataaattaatgcttagcatgtcacattcatcatataatttaaataacatggttatatC
AAACACAAGACAATGAATGCA
Primer
(+)GTAACAATGAAAGTTATGACCCTGA
(+)TGCATTCATTGTCTTGTGTTTG


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.