Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs895 ]


Position: chr12:24,233,884-24,235,634 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: SOX5(intragenic)

Timepoints:
e11.5

Expression Pattern
hindbrain (rhombencephalon) (5 out of 8 embryos) 
limb (5 out of 8 embryos) 
trigeminal V (ganglion, cranial) (5 out of 8 embryos) 

Embryo 1


Embryo 2


Embryo 3


Fasta sequence
TCCATGTACTTGCACTTATGTGAGTTagaattattttagcctgctctctgtaattattag
cagtaatacgcttattaacttgtgaatttaatacatatggcatcagtgtaaaatccaatg
atgatatcaagagaaatcacaaaatgatcgttttctctctttatcctaagctgagcaagg
aacctttccaaacagtgtgaactcattggcttccccataactctacagagctcgcgctgc
catataactgggaatcagagaggtgaggtcatttcatcactccttgcaaaaaaatgcaaa
acgtctgctaaaatctgacttcatttgatttactctccaagactgttttttattaaatat
gtttgactgctatctctaattaaatgtagaattaattttggcaaactaaccacagatgca
gtttatgttcaattttatcagacagatttatttataagctgtcaacttcttgaaagactt
cattttggagcagttttaaattgctaacagtagctgtaaatggagctactgttctctgga
acactaaaggaaaagtatgctataaatgtccattccatctgtgaggaatcataaaacaat
cacattcctttattttttttcctccgtaggacctttattaaattagttcaactcaattaa
aaataacttcaaaaacatttcagagccttttgtttcatggaatacttggaactctctgca
cggaacgtcacccttttaactaatcccttttactaaatggaggagaatagtggtattgtg
acttcagacagtgctttcaagggtctctactgtaccgaattgaggtcactgcaagacaat
gctcaacacccaatagccattcaaacgttcttcacaactctatcaaacgtgtctttcttt
ctctcacccgctttctctcatggcaaactcagaggacaatggaaaaagcctccagcacca
tttatggtcaccatatttgcacatgacaaaatctattcttcctggtttgccaactccctg
taaaaagaatgaaccctgggatagattttcccaccgttactgttattcaaacttactttg
tatttaattttgttgttgttgttgttagagggctgatgcatggcatttgagaagctgact
tgctattttcgagcatgtgtaacaaagcagagactaaatgcagaattaaatatgtcacat
tatagccagcatatgcatgacggagcgtacaactcaggacaaagcagagacaaatgatgg
gactggaactattataccttgtcttattgtttagtgttatcagtattataaaactcactg
tttccctgtgaaccaccatgtctgtgccccacaagcactatttagttttgcctgggagtt
tttatggctgcagccacaaacaaacaaaatcaattgctgtaaatttctctcaccagggct
gctcctttcgaaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaagatgtatccagagcc
tcatcctccaaacaaacaagaaagaacacatatttgcaagctatatagtaaagttgttac
aattaagattttgattttaattaagaatgggatttgtaggacaattagtgagatgtaata
ttctttgcaagaaacggtgcccttattggaaataccatataaaatggaattgggggcatt
tggagctgcacagagacttgtttctatggatttctacagataaTGAGAAGAAAAATACCA
GCAAAATGtaG
Primer
(+)TCCATGTACTTGCACTTATGTGAGTT
(+)caccATTTTGCTGGTATTTTTCTTCTCA


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.