Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs824 ]


Position: chr18:72,567,672-72,569,282 (UCSC browser)
Source: University California San Francisco

Flanking genes: ZNF407 - ZADH2

Timepoints:
e11.5

Expression Pattern
limb (6 out of 6 embryos) 

Embryo 2


Embryo 4



Embryo 5



Fasta sequence
aAtaTCTTCTGGCCTCTTGTATAATGCatgcaacttattgtaaattaactgtttgtttga
agcttatctgaattcttgttgggggtagctgtgaagagggagggtggaaacacctaacaa
caggagagattatttggtgttggaagttatactttacatttttgctttatcccattcaat
ttgacttgatacacacctcacactgaaaggcgtgtagagagctgccgtattatcactttg
tcaaaggctgtgacaacagccctaacaataagagagtcttcccttttgtttacaacactt
acatgtcttggcgattagaactttccctttcttctctgaataaaattgttttgttcggac
tttttttgttccagtgaggagaaggaaataaaagcaaccctattttctattacaaattat
cataaatattggagatgcagatttttcttagatcattagcatatcatgctgcgacccaca
ccagaatgtaccattaacaaagcagccttcatgtaattaatgtaaataatatggaataca
gcttgagttacccagtcagccttggcaaaagcatttgtcacaacgcatcatctaaggagc
tcggccccaattcaaattaaacttcatgggtttgcccctttattttttcctctcacgcta
taaattcctgtgaaacatttatgactataaatttctttgaaacacctatataggagaaga
aagcaatctagtaagctgaaattaaaattttattatttactatgcttctgctggtgagga
caattagtatctttataaagccagaaatgtagaacctggggatgcagctgagggtttttc
ttcccatccttggaagtgttttctgtcctctgtagctgccagcaaatctaaagtatggtt
tctgtctgccatttgctactattgccctctgactccaaaacacagaggagcattgtaaat
ttttcatgaagaggtttcagtctgtaaaacagcaaacaggaataatgttttaaatgcaat
cattgtcaagtttgaacaatgtaatttatcaagagagcagtttgtactatataataagtt
tcatatattaatacaatttttcatctgatgtcaggcttctgatttatgaatagcccatga
tctaaggtgatcattgaattataattcaagtaataagaagccaggaacaagacactggaa
ctgctatcctgcgttagcttacatgccaccaagccaatttactaaacaaccgtgggctaa
atgatacagtttttctaattcaaagaaggcactcgttaattagataaaggctaaagctct
cattatttttaaatgatttaagaacgggtaaagatcttacagcgtatactgcagctctaa
tagttctctgcttactgccttgtaataagagtattaaagacagatgggcaaggccgattt
aaaccaattacagcgtttcatgtacaccagcagcaatgactattcacaggcacttcagag
gctgatattcgacgtgtttcagatggctaacacagcactgattaatgtgatttatgaata
atttgttttcttctgctaattttgggGGAATAACCATACTTCTGGACTATG
Primer
(+)caccTCTTCTGGCCTCTTGTATAATGC
(+)CATAGTCCAGAAGTATGGTTATTCC


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.