Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs645 ]


Position: chr1:32,510,030-32,510,913 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: KHDRBS1(intragenic)

Timepoints:
e11.5

4 of 5 embryos with staining in ear and/or underlying cranial ganglion (identity of structure to be determined).

Expression Pattern
other (4 out of 5 embryos) 

Embryo 1


Embryo 2


Embryo 4

Fasta sequence
CCCCTCCTAAGAGACCAAGAGAggaagtgatggaattggttggtcccatttcaactctat
gctgattctcagggttctcatggcttccctaagagagccacctaaactgctcgggggtga
aaaatcctcttgtattgaagtgccaagctgcctgcagcagtgcatgatggacattttttt
tttctttttaaaacacaccaacaaaaaaatgtatttgtagattgtgataaaatgtaaata
actgaattttcaaccatggtttgaagtcagctttcagggcattatgtcttgttttgatga
aaagagatcactctatacccccctttttaaaggaaaattatcgcaagagaatcaggatgt
gtaaagctaacatgcatcgcaaaaaaccaaaggtaacctaaatgtctgattttaatagca
catatttctcttttacataaactgtgacagcaacttgcataaacaattctttagctgtta
attttaatgttaaaactttgcaaaacttgtttaataaaaatagctgtaaaaagaaaaacc
atatgttgccgcataaattagccataactcttaataatcctgcccatcacaagtgaactg
taacgtaacctgggcacaaagtctgacatcttaaatgacacattgtaaaatttcaatgac
tgtagattagacctcctgctgcaccccaaaagctttctgctcagctatttaaaactgtgt
aaggatgagtccctgtaggtccccatattgatattcacaatgaaactttacttaaaattt
cttaaaagttgcatgtttctcctgtaatgtgtaaactgcatgcaggatctctttatcttt
tattttgtatgtctttaaaacTTCCTCTTCAAAAGACTGATCTG
Primer
(+)CCCCTCCTAAGAGACCAAGAGA
(+)CAGATCAGTCTTTTGAAGAGGAA


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.