Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs630 ]


Position: chr3:71,277,312-71,278,956 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: FOXP1(intragenic)

Timepoints:
e11.5

Expression Pattern
neural tube (3 out of 7 embryos) 

Embryo 1

Embryo 2

Embryo 3

Fasta sequence
CACATCACGGAAAGAGAGGAtatttagggagttctaggtcactgggatgcttcctcagtt
tagtgacaagagatttggtacctaagtggagaacttactgttttcaattctctatacgca
ccgaaattattgggttaaataaagacatgacaagccataaatcaacctgctttttttttt
ttcctgtggagtttttactcaggtgtactctaaatgtgcattaaactgcagctccattaa
gcagttacaatgaaggtaaagggcacaaggctaaacaccacaggaccttgtatggatctc
atagctttaatggaatcaggtttttaacaactcttttttcgttaaatacagtcagtgtca
ggaagatgcgtcccactcataaagcagcgcaatgacaatgtacagtggcactaacacaag
gacatagttcatcatgacatttccagcaattcccaactgattagggtcattatgttggag
gtctgatttatgttgtcatttcctctcaccgatcctgcatcaatgaatcttaatgaattg
gtaaataagggtgaagattacactctatgacactgaaacattcctcattctcaacacccg
agatttatgtagccaattagtgactaacagagaaaattggctggcagaaaaataatattc
tttatggtacaaaatggaaaaagctttctcgttgaagggcaatgccacagcaaaagtcca
taaagtagcttgatatgtggaaacacaaaagatgtttaaaatgtgctctaagagggtttc
ctagtaaaatgcttttactgttggttgttttttttttttttgatgtctcattttttaaag
gttattggtttaatgagcagacctgtattttataaagggggaaagttggccttttaaggg
gaaagagttaagtacacccctatattatacaaatgctaatgctttgtatttactgggaga
atgggaaaaataagcaaagacgacaccagtttttcccccagttttagccgagataccagt
ttctcctgacttcttgcagacaggtagccataatgatttgtacataatcagagaacatta
aaatctttcattctgattaattactagtaagtgtacttaaagtactgagcatgtttcaaa
taccagaactttttaatttaaaaaatagcctaatcattaacacagaaatcactcagctta
ctagtattattttacattcacctgttcctgacctcattataaaaccagatgaaatgactg
tcataaacaggaaaaaaaggtaaaaattccccaatgaaacataattcagaaaatcttggc
ttcacctagtgcttgaagcgtaaccctatggagtgtgttcatgaatgcaaagcatagctt
cagagtcattactgcttaagtatatacttaatgttgaatactgtcagggaaaaaaagggt
tctcaaaatccacgtatttattcagatttcatcatacaggctccacactatccttgtaga
atatgcaaatgggccgtgtctctttctttcagctgttttctagtcaatgtcaagaatgga
gctttgaaatttaaaaaaaaataaaataaacgccggaagttggatcagctacaatgggtT
CTCCGTACCATCTCCTTAAGGtacc
Primer
(+)CACATCACGGAAAGAGAGGA
(+)CACCCCTTAAGGAGATGGTACGGAGA


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.