Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs580 ]


Position: chr2:156,403,022-156,404,115 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: KCNJ3 - AC093375.1

Timepoints:
e11.5

Expression Pattern
other (10 out of 12 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Embryo 6


Embryo 7


Embryo 8


Embryo 9


Fasta sequence
TTGGCATATGTCACTGGAAATGttttccagtagctcacacaagcaccaaacacaattttg
agtttctttctattgagtttgcaataaattaatttattttaatttttttaaaaagttgca
agccagagacttagccaattgaaaaacaaaacaaaacaaaaaacccctcaaaaacccagg
caccaaatttagcaatacaataagattgagattgctccttcacagagctaattctcccag
aatccactgttcgtctcatcactccttataaaatacagaatccttaattggtctgtgctt
ctccaacatgtttttaatgaaaacgcagcacataactcttagtttgttggctgccagagc
ccaatttacaaaagtgggagtgcgagataagaaaagagtacatctgcagagcaggctgcg
caatgaatcacacggtgccagagttgagtagaatataattgagtccaacatctctgagca
ctttcaccataattaatgataatctgtaacagaggaatctgagattccagttcagagaac
tgtttaattaggccaagtaatgaaagcagaagcagtacaagaatatggcctgtctcatga
ttaatgattcatgctactgaacacaaaagtgccgcaccgttaactctaacggatgctgca
tctctctggcatttacaaaatagtgaaatgcatgcatttttgtactttaaagatgtaact
ggcagtatccttttctgagctatttacgtgataaatatggttccgaaggtaactgtcttc
ttcacaggttctttgctctggggtagtttaagataaatatggtatctgcctctacatcag
tattaaggtaagtgccattccagtacaggatcattaacactttcactttcactttccaag
tcagtaaaacattattttcagtcttactttggttttaaaaagatgtatcttttatggacg
aaatcacccatcttaatatttatataatattcacttaataatacaataaagaaaaactag
gttaagaatcaatcataaggtaaagaagatataaagcatgtttgatagttatTATTTGGG
GAGGTCAGCGTATA
Primer
(+)TTGGCATATGTCACTGGAAATG
(+)TATACGCTGACCTCCCCAAATA


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.