Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Mouse element [ mm55 ]


Position: chr2:71,256,536-71,260,128 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: Hat1(intragenic)

Timepoints:
e11.5

Expression Pattern
forebrain (5 out of 5 embryos) 

Embryo 1

Embryo 2

Embryo 3

Fasta sequence
ttCCTCGTGCAGCTGTTGAAAACTggatgtctccacattcacagtttcaggcaaaaaata
tttatcaaatagtatttattaaatttagtttatttgcaattgaggatgacttgcaagtac
tgatatacacattagaaaaaccagtcaggctggatgttgaaaagcattattttaagtaat
aggttatttttatgaccataaatgaatcatatataaatgttggtatcaaagcattgggaa
taaaactcatttgtgataggctccatccttatctctatctgaaaatgtaactgaatgata
ataaagtactattcatctgcaggtgcattgctcctacttagttaaaagatggttgaaagg
acaggaattagtagcatgttgtattagccttttgtagtgtattttgtcctaagcatctta
atttccctgttttgaatgctaagtagcaagggtcttggtttagaactaatacccatcatg
catgtaaacggtatgaaagagctgcttagtaagttaacacaaagtgttcttgtgtcagtc
cttgtggaaatagatacaatacaaacattacagctgaactcacggcaaactccattaagt
aaaaacctggcctcattgttcaggaaaaagtttgaatagaatgcaagctcattttgttga
atgtaatgtcaggcttttaggggctgtattgaaggatacggttttgttaagttgagacca
attcattaagttttattgcctggtgagaaggagtaatactttattgtaagacctcatcaa
atattcatggttaaagagaagtagtaaatgtattcaatcaagtggtcttttggggttttg
aaaaggattatgaagtctgctcagctgatagttttcattcattgagcttgtttaacaagg
gtgattttaatctgtgagtttaattttgttgtccagtcttttctcttttatacgatcaca
aatccaagtctatgaaagttgtcacattgtggagatcaatggataatataaccattcata
tgatttttctatttcctaagtgaagataaaaaattcccatcttagtttagcacatgaagg
tgttatctgtctgctttgctattcatttggtcagactatctagcattaccacttacttac
tgctgcttatcttctcatgtcttgaataataaggtttctttgacacgtgcaaaataacaa
gcagccttttgttttggcttgttaagattgtcagaagggcggtaggtaataattttctat
atgatgttagaaatctcagtggaacagctattactcttgcacttgatgttagactacctg
cctcttaaatttgttttcctgttaacgttcatctcaaatttgtgtgagagtagtttgttt
atataaaacatcctttcccgttccaccgcattgtttacttacatagtttatttgtgaagt
tttgtgtgatacctgttggttttgtccattaacgaatcttgttttgttttcaaacatggg
gttgctccctagctggcctggaacttgttatgtagaccagactgacctcaaactcagaga
tccacctgactctgcttcctgagtgctgggattaatcactacatctaaaccagttttgtt
cactttaaaaaaaagaaaatattttcagttaaaaactaaatttattaatttttatccttt
gttctctattcctcaggcagatgatgttgaaggcaaaatcagacaaatcattccacctgg
gttttgcacaaacacaaatgattttctttccttgctggaaaaggaaactaatttcaagcc
ttttggaaccctcctccatacatacacagttcctagtcagacaggaggtgaaacctttac
tttccagatccacaaggtaaaaagaagtagttccctttgcatggaacctgtatgggattt
tatattctgcaaatgtagtgtgagataaaaaggttttattgacactaactagatctgttt
tgactgtctgtttgtatacatatttaatctgagacttctaaccattttcccacaggatag
ttttgtgttctacagactttcagttacctctgtgatgagtttcacctgacttttcctggc
tttttccctaggctgacatgacatgtagaggctttcgagaatatcatgaaaggcttcaga
cctttttgatgtggtttattgaaactgctagctttattgacgtggatgatgaaagatggc
actactttctagtgtaagtacagttctaaagcaacagtggaccttattacctccacaaag
ccagcattttaattgtggcagcccaattattggggcagtataatgatatttttcccagga
aagaaaaactattgtttatggggcttgagtttgccttcattatgctttgggggacttgag
aatggaactgaattaaatgctgttgtccgttaaggccctgaatgtaggcttaaacagtaa
aatgagctttgcctgtgttttcttttacttgccacctattcatctttataataggcaagt
gcactgaagtgatgtaaagaggtctgatttatccaagttgctgcacaccaattaagtgaa
ttgtacattcagaacatagcaggtgtacccattgggccctcacagagtagcttgctgaca
ctgaaaattcagtcagagaatggaaaagaaaatggacactgcatgggagcgcgactgtaa
ttgacctgcttggctttctgttttatctgcagatttgagaagtataataaggatggagct
acgctctttgcgaccgtaggctacatgacagtctataattactatgtgtacccagacaaa
acccggccacgtgtaaggtaattggcagtataacacgtgccttgtcttttatttcagaag
gaactgctgaagtttccaatacttgttatagtaatgttgatttgttttttgtttttaaat
caccattcattggctatgtactgatttattttattgttctctttgaaactgaggcagagt
agactaattttgtgtatgttggtaattttttggtttcttcaagtttgatttttaaaaagt
accaactttcatacgacaataatttgacaatttccaactggacatgataagatgttttaa
tttagatttatttatttatttatttttactatagtcagatgctgatactgactccatttc
aaggtcagggccacggtgctcaacttcttgaaacagttcatagatactacatttcatttc
ctacagttcttgatattacaggtatgtaaaattttatgttactagaagagcctttctcaa
atatcttagttttatttctgtcttaagtgtcagtattcatctggggactttagaggactg
tttgaagatttcttttagggtacattttagatctaagcttttatggagatcgggctgcat
ccctaactaaagtggacaacttaaaaataatgaagtaaatatatttggggaaattgtgat
cagatatagatgcgtgctaagtatgctgtaacttatttgtttaacttatttggcaaagat
tacatcacttagaagatacccatgtgttaatttTAAACCATAGTTGGGGGAGC
Primer
(+)CACCTCGTGCAGCTGTTGAAAACT
(+)GCTCCCCCAACTATGGTTTA


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.