Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs521 ]


Position: chr2:236,773,458-236,774,696 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: AGAP1 - GBX2

Timepoints:
e11.5

Expression Pattern
branchial arch (6 out of 6 embryos) 
ear (6 out of 6 embryos) 
eye (4 out of 6 embryos) 
limb (6 out of 6 embryos) 

Embryo 1




Embryo 2



Embryo 3


Embryo 4

Embryo 5

Embryo 6

Fasta sequence
ACCCCAGCATACAGTAGCTTCAttggctttttttctgcccatattcaaaattcctttgat
tagcatttggttctggttgggacttaataatgctagccagacctaatgtgaaccatacat
ctcgtcggcattactcatcgtcaacatgggtttttaaaagggaaggagagaaacacaaca
aactttttatttctttccctgtcattgttcttggtcttgttattcagtggacgctgtatt
aaattggattctgtgtccatcattattaaaatgtgaagtgtgtcggtcacaaagcataca
tttcggggcagttagctgaataattcttttctttattatcccaaattactgctgagctct
ggagaggggagcagtttagccaattattgccatttgagctggatttgtgggtgattagct
cctggccgaatccagtcccggccggcgctttgaagcctgtgctgtgcgattttctcagca
gtgaggtaggaatagacgcggctaatgacaggaaggtcgcgcgggtgagctgacctgtgt
gtggcgcagccttgggttccgcaaatagggcacccacagtaacacgtgtggcgccgaccc
cgccgtgcgcaatcggggctttatacgattgctggagatgctgacagctcaattaaagtg
taaccctttgtgccctgcaacctggcacaacgacagaaatattactcgccggaaagggga
gggggtctttggggagctggttaaagatccagaatcggcccctcgcccctttgcccctcc
cccaactccctccactgtacagaaggagctgcagaaaagcctccatttgtaaaataatag
gtgctctggaggaggggcagggcgggaaatattactattttaaaaagctcagttaagggg
ggattcctgctgttcctatggaaacactttaaactagagagaaagttaaaaagatttagt
agcggcagagcttgtgtctgctggtcacattttctagtcatctccttttaccaaaattta
cctcccagcatcgtggatgtgaatttgccagaagttttccgtttgtggaggactggggaa
agccagttaattgggatgtgtttttgcacacaacgaatgatttctatgttatcgatttac
ttctttcacttaacggcattttctgcagcttgaatgaaagctgtctcgatccatgtatgt
ctgtgtatctgcggtctGGTCATTTTTGCCACACTTGAT
Primer
(+)ACCCCAGCATACAGTAGCTTCA
(+)ATCAAGTGTGGCAAAAATGACC


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.