Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs358 ]


Position: chr15:67,665,164-67,665,685 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: IQCH(intragenic)

Timepoints:
e11.5

Expression Pattern
branchial arch (3 out of 11 embryos) 

Embryo 2

Embryo 3

Embryo 5

Fasta sequence
CACATTTGTTTGTGCATCatagtttagccctaatcaagaatctggctttcgtgcctgcaa
aatctgttgcaatttttctatagaaaaaaaaaaagtcccttcactttgactatggtagtt
ctgtcagaaaatcaatgttttaactgcattactttttctccctatatataccttctggca
ctttaatttgctcagaaaaaaaaaatcctctcttgtctacattgctgtcaccactttgtc
agaaagtatttaagtttgcagacagccttttaattagtgctcacaatttcatttatgttt
gctttctctttttttcattcatattctgttaattaagtgagctgcctctaatcttcccct
gccagtagcatcatgtagccacctaattaaattaattggggaagatgttttaagtatgta
attaaatcaattaatataatttatgcctggcttaactgtacagtggaaaaacagctgaag
tttgactagatgaatccactaCAGCTTCCTGTCACTGATCAA
Primer
(+)CACATTTGTTTGTGCATC
(+)TTGATCAGTGACAGGAAGCTG


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.