Human element [ hs286 ]Position: chr10:102,419,119-102,419,731 (UCSC browser) Source: Lawrence Berkeley National Laboratory Flanking genes: HIF1AN - PAX2 Timepoints: e11.5 This sequence did not show observable enhancer activities at E11.5 We define a negative enhancer at this developmental stage when at least 3 transgenics were obtained and yet no reproducible pattern of expression was observed. This does not mean that this sequence is not an enhancer at another time point or a weak enhancer at this time point but below the detectable range at our level of resolution. Fasta sequence CcCCTGGTGGTCCAGCCTCAGccccagacccacgcagtgcctcacgctcgcctgccccgc ccgctccccgcgggcctgcgcgtgactttagcgcgcgcggctccgcccggaaggtcacct ccttcatcacggattctatttgcatccggaatcgcatgtacatgaaaaatgtgtccgcgt gcggccccgactgcagacgcagatgaaattctgtgccgagcctgatgcgcggtaaccttt gcagatggcgccgctattgctgagaaatggattgcttaataaagcgtatcatccggcata tttgctgcttggctagccaaatagaagttgttttttgcacaaatttccttgtcaaatttg tcaatgttcatgtcatttttgctttaggtcacagagcaaggtgcaaattcctggcatctt tactagttgcagccaatttcggcgatttcggcggtgacggggattctcagaggagccgcg tgcccgtgcgctcccgcctgtcggccccagagagcgcagccctgacacctcctcccggaa gcccgccggcccgaccctggtttggaaggagaggctcagggagtgggacagagggtATCT CTCTTTCCCCAGCGTCPrimer
|
For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.