Human element [ hs2489 ]Position: chr5:125,995,893-125,996,243 (UCSC browser) Source: Lawrence Berkeley National Laboratory Flanking genes: TEX43 - LMNB1 Timepoints: e11.5 Published in: Hum Mol Genet. 2015 Jun 1;24(11):3143-54. This sequence did not show observable enhancer activities at E11.5 We define a negative enhancer at this developmental stage when at least 3 transgenics were obtained and yet no reproducible pattern of expression was observed. This does not mean that this sequence is not an enhancer at another time point or a weak enhancer at this time point but below the detectable range at our level of resolution. Fasta sequence agtCACAGCCACAGCCCACATAACtgaggcagatttagagaaattggatcatgggtaaat gactttcatttcctataagcaaggttgatgatgttgctgtttcactagtacaggctgctt atgaccatgttcattctgattgatgaatactactgctgaatagtgtgtcaatgattttga ttactgctcttttctgaaagcttttaggcctagcttttgaaaacagaatgatctagaaac agagagaagaatcattctccaccaccaaatacagagtgctgagtcctcagtactgaaccc aaaggctggtaggtcatagagagtatatCCTGAGTCTATAAAGGCAACTGAPrimer
|
For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.