Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs2353 ]


Position: chr10:97,267,716-97,269,342 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: SORBS1 - ALDH18A1

Timepoints:
e11.5

Expression Pattern
heart (4 out of 6 embryos) 

Embryo 1



Embryo 2


Embryo 3




Embryo 6


Fasta sequence
AGCCAAAAGAGTAGTGGCCCagacttttttttttttttttttttttgagacagagtcaca
ccctgtcgcccaggctggagtgcagtggcatgatcacagctcactgcagcctcaaacttc
tgggtgcaacaccacgcccagctaatttttttagtattttgtagagatgggatctcaaca
ttttgcccaagctggtcttgaactcctgggctcaagcaatcctcatacctcagcctccca
aagtgctgagattacaggtgtgagccggcacacccagcccagactattcagacatgtaaa
tatttgacacttttgtggaataaaggctgaatatggtatttttctacactgattaaatct
ccaggaaactgcttcctaaaaaaggtcactgcaatgttctcgactaatggagtatatgat
gctgaaagttcaagtcagactcatctaagccataaaagcctatcaataacatttcttgca
tttgtatagtgccattacttttttcaaaatgcatctattacctcattttataccacttat
gtcagaacaaaaggaagagtaatgtgttgactggttggacaaactgtaccgtcaagaatg
ctcctatcctctgaaatggatgaaagttccagacacgaatgtcagatcagcgggaaagag
ctttccaatgagaagagctatccaacaatggaaagagtggctcctagagagtgagttcct
cattgccagaggtacacaagtagaactgttaaaaccgtgtggcttccaactgctctaata
actttaagattcacagtcttcaactttcttacagtggaagccatgggggcattgtcctgt
tgccttctctctcattcctcattaatgagaaagatgttaagctcactgacgtaagtccca
gtgaagtcttctccagaactcagaagggccataaatagagagacaaagggcaggaggtgg
gagttattcaccagcgtggaggaagcaggataagcccagaggaatggcctctggaattat
acaaagaatttggaggtgactgggggtggccctgggaacaaagtgaaactgtcagaactc
agataacagtccacgttcctgagattggattgtagcagcccttctggaaaaggagcactt
cttgggactttatacaaatccagctgggtcccccacacactgcctcacaaaccctgtaca
tcaccaaatatgaacagaagccgtcttttgagagtttcctgaaactgagagctcaaggaa
ggtaccttctaggaccgcccccttgccccaagttttccagaggccagcaaacaatgaact
agggttgtatattttctctacactcttacttttatgaccaaagcaaaggataaaataatt
ggtaatctgtaatttggtccaaaaaacaacctccaggagatgccttaaattcaatccaga
ttctgacaatcccctggttttatttggtctacagagctcatagcaacacatggcccagtt
caagccaataacttagagttttggagcagactttaaaagtcttattggcaaaatcacaaa
aggccaaagaatgcacatattattccaaataaggaaaccttgtccctCTCGGATAAGGCC
TGACACC
Primer
(+)AGCCAAAAGAGTAGTGGCCC
(+)GGTGTCAGGCCTTATCCGAG


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.