Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs2321 ]


Position: chr2:122,712,120-122,715,253 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: TSN - CNTNAP5

Timepoints:
e11.5

Pancreas staining as published in: Parker SC, Stitzel ML, Taylor DL, Orozco JM, Erdos MR, Akiyama JA, van Bueren KL, Chines PS, Narisu N; NISC Comparative Sequencing Program, Black BL, Visel A, Pennacchio LA, Collins FS. 2014. Chromatin stretch enhancer states drive cell-specific gene regulation and harbor human disease risk variants. Proc Natl Acad Sci U S A, 110(44).

Expression Pattern
other (4 out of 7 embryos) 

Embryo 1


Embryo 2


Fasta sequence
TTTGTTTGTGTCATCTCTGATttctttgagcagtggtttatagttctccttgcagagatc
tttcacctcccttgttagctgtattcctaggtatttttttttttgtgtgtgtgtgtgtca
gttgtgaatgggagttcatttgtgatttggctctcagcttgactgttgttggtatatagg
aatgctagcgatttttgcacattgattttgtgtcatgagactgctgaggttgcttattat
acactgcggttgtgaggttaaattcctcctttgggaaacttcagtttttgctcttcaggc
cttcagctgattggatgaggctcacccacatgaaggagggtcatttgctttacttagtct
tctgatttaaatgttaattatatcacacaatacctccacagcaacattcaggctatgctt
gagcaaacaacagggcaccatagcctagccaagttgacagtccagtgtaaagtccatcct
tgatacttctggtagccctggtcaagcattttcctctttggtctcagtctgcccatgtgt
aagagaggtggctatattaggaaggtttccagggccttccaggtgaaatgttcctgcttc
atccaggagacctgatgaccccaggtacaggcagtagaaagtactttgtgggctcctgta
cagacctcttccccaggggttgagcacccccatctctgtttctgtcagtgtctccctgat
tcttattctcctctttgcattctgccatgcacatagtccaaggggccaccagcccagccc
caaattggcatgttatgacaattccatcacccattacggattagcatagctgtgtccctt
aattcagattccagggagagacagtatttggttgctggccagccagctggatggctggag
ctgtgtcaggtaccaactccaggtttaaccagctctggttgggagcagaatcctttggcc
agctgccagctcagcaggtgctatgggaacagattcctggagaaaagccccgtggggagg
gaggcggccaggagataggggctgcccgggcagttcaaattgactgatgcgtccattaca
gttcctttacgcttaatgatctgctgccttgctgttgtcactgttgatttgtttggtctg
tggagactgtgtggaccacatggcattaaaccccacatcaagggcactcatgctgatcat
gacagccatggaaaggagtagagaggaaaatattttgagggcaaacagatcaagaatgag
aaagccgcttttgccctcactaatgaccctaaaatttactcaatgatccagaaaccctaa
aagtaaagccattagtcacaatgttgtcagagtaaaaaggaaagaaagaataagccgtgt
gttatcattttagaatccattccacacaagtgcccatttcaaacgcctgaatgcctgaac
catgcaggttgatttaattatcgtttgccctgcatgctatggagtcagccacatgccctg
cacaccccagcatcaggggatggcctgtgtcaagctgagggctcgtgcatttcctttgtg
cgcaggggctggggctttcttgcctgcccagctgagctgtcctcctgtcagctttgaggg
cagcggtgtccagtctccgacggtgatgtagacaggacctccgcatcacttctaggacat
ctctaggtggagagtgagaaagagagggagaatgctcaaacaggttggggggctcaagaa
cacctcccgtgagtggggggcagcccacttgggggtgggagcactccctgatttcctggt
aagttgccgcataatatgtaatcattagattatttgtttacttgtttctctcccctgata
gactaaattcacagagggcaaagctcttgtcttgactttgcaataataatagttttcatt
ggttgattgcctgctattggccatgttctatgttgaattctttacatatattagctctaa
tctgcatggtagattatcgctctttgacagacagggaaatggaggctccaagaggttaag
tacattgtccaaagttagacagctgtatgggacacagttggaatttaaactcatggactt
ttcatctttccaagagcctcttacatacgtgatgtctgcaccatactgagtattaaatac
atacctgtggaatgaatgaagatatacgcagctgcttctcttcctcttctctatggctcc
tctatggcctgttgaactttgggagacaaggttggctgttggcaaaatttgaaaatctgc
cctccctttctttgtgtctttcctattttgcaagctaccattccggacctagaagcaaca
caatgtagtggaaagaacactcaatttggatttcaacagagctggcttggaaccctggct
ccaccgaaagctctctggagttatttaacctctttgaacctcaggttccctgtctatata
atgagaataacagcacccatggcagaaacatggcgaggatttggtggcacaaggatgtaa
gtggcacctgggcactgggctcagaggtggtattcaggaagtggaagttcccccattttc
ccccagccaccttcatgcctgatctctgccccactcttgggctttagagacacgtgctgg
ggtcttggttcctggaaagataaagtgctacaaaaattaaattctagaaaatcctacaga
aaactagaaaactcggttctctgaactttagtcattaaaagtgtcacacgcaagggatga
aagattttaatttgattcaattcagttctgttctgcagacactggcgccacagcccctgc
agtaggcaatgagctggcctgaggacacagaactcctgtctcaaggtgttcacactcagc
tctgggggaaagacagctatgaagcaaatagtttgaaatgtagaacccttgggtacaaca
gagaactgtgtagtaggtcccaaagcggcacaatgggagcaggggcacagaagggcagag
agccaggggaggcctctcagaggatgaaatgaataaggtgagtattaagggatgaatagg
tgtttacctgctaggagaggaggtaggaaagtcacaggaaccagcctgtgaaagagatGG
AGAGGCCACACTGT
Primer
(+)tttgtttgtgtcatctctgat
(+)ACAGTGTGGCCTctcc


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.