Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs232 ]


Position: chr10:131,691,086-131,692,848 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: MIR4297 - LINC00959

Timepoints:
e11.5
e12.5

Embryos 1-5 are E11.5; Embryos 6-7 are E12.5.

Expression Pattern
hindbrain (rhombencephalon) (6 out of 7 embryos) 

Embryo 1


Embryo 2

Embryo 3

Embryo 4

Embryo 6

Embryo 7

Fasta sequence
atgaAAACGCTTTCCCAATCTGTGacaacgcacttgaacgtcgccatcaaatcataaccc
ccaaatatgtattttcccattttaggggagggcgccggcagccagccgttaattagcata
cttcccatgctcgtcatgaagtcacgggctaatctggcacacacggttcggaacaggctc
ctgcctgaatcaatcgtgagagcagggcgctgggccctccctcccagctctccctttata
tttcaatagtcctatgacaataattgattgtgattcactcctgaaatgtaccaatccccg
ggaaatggcatgggctttcattcatcaatttcagcttcataagtggaaatttatacaagg
tatgcagatgtttagagtttggggtaatcaataaggagtaaataaagattggcattcact
atactccacttgacaagccccagcctaatgtttgtcaagcaaattaaacacactcagact
tttcacctgctccgacaacagcaccacatatggccctgaagttaaaaataagaaaatgtg
catacattatcatacataatgtacaactccctccatttaatatgcaaattttgtaaaata
ttactgaataccttctgttctaaatgaataaatttgaattgcaattagaataatcttgta
taattaatgaaaactgtcaatttttgttcataagtaatttgattaacatgttgataggac
acttatcaagttcagtaaactgttagattaggaagatgaaaaaatttgaagaaaattttt
accagctctgacaatttcccctggcatggtaaacaaagacttgctggcaaacttcctgac
gccgggaacgagcctctccagctaatctgcaaatcacagcgcacgcatgaaacccggacc
accttctccatttcttctgcgctcccctcctctccagctaagccagagtttaaagctaca
gttaatttcattgatcagtctgactcggaacgtctgctgaggtcaacagcaaggtgagcg
cctctgttacaggaagcgtgcaggcctgtcagcagacctgctggcttccctggtgggggt
gcacggggccccacgtgtgagggactctccacagccaccctccgtttggggtgaacaaag
cgcgtgcttctcctacccaagccccactccccaactcgtgtggctggagatgcaacccac
aggcagaataatttcggtaaaggcttaagtgcccccctccttcctattaacctgctcccc
agtcctgttcctgttcttattttctaatagaaatgaaacttttatgatatagacgtgggc
tggcttaaagggaaaatctgtcaagctggtgatctgcacttgggtgtctcctgcgcagaa
ctttagatgtttaattcataaatcctgtcatccatgtaaacctcctgatttcataatgaa
taactcttcatcatttaattaatttaataatgcctttcaaaatccataaatgaagggggt
tctaaaatgggtgcattaattagtcacaacgagggctgaggactcacttgtcaaccctga
gcctgtcagttttaggacgaccagaagagatgccaaggtctgtacccatcacccaggacc
ttgcccccgtggctggcacatcccacaggtcccaggggagaggccccctgcagggctcgg
tgacctatgatccagcaccttgcctctgggccccgcctctgtgccccagctcctcctcag
accGAGCTGGAAGGAGGCTTTCT
Primer
(+)CACCAAACGCTTTCCCAATCTGTG
(+)AGAAAGCCTCCTTCCAGCTC


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.