Human element [ hs2305 ]Position: chr9:99,277,745-99,278,295 (UCSC browser) Source: Lawrence Berkeley National Laboratory Flanking genes: CDC14B(intragenic) Timepoints: This enhancer was generated by the Ahituv lab at UCSF (http://bts.ucsf.edu/ahituv). For further info contact: nadav.ahituv@ucsf.edu This sequence did not show observable enhancer activities at E11.5 We define a negative enhancer at this developmental stage when at least 3 transgenics were obtained and yet no reproducible pattern of expression was observed. This does not mean that this sequence is not an enhancer at another time point or a weak enhancer at this time point but below the detectable range at our level of resolution. Fasta sequence AGGAACAGTGAAGCCCACCTtccctccccaccaccatcccattaattgaaaagattcaga aaaagaacctttgaaaataggcaaaccaacaaagctaggagctgacaaggagaaaaacat gcattgtgggaaccacactaggcaccagaagtaagcaacggcagagaaacagaacgggac acttacagcagctatctgtcagggggtcctgatggctactgtgttctgaaaccatcgaga cagaatagcaggatgggaagaatgtagtcacaaacaatccaccagatgacaacactacac agtgcagaggtcagcacagctaggggacatctggaaaggggtgaaggggaaagaacagat gttcaaattgggaagccaaaataaattacgcaatcatcaatcaatcaagccatatgtgaa ttttagacaccctaaaagcccagccaacagcaacagggatacaaaggggtggtcaacaag gatggagttttgccattttatgttgaataaaaaaatgctgtgtttaaaCAGGTTTCATAC TTTGGGACTCAPrimer
|
For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.