Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs2248 ]


Position: chr21:44,010,872-44,014,322 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: SLC37A1 - PDE9A

Timepoints:
e11.5

Expression Pattern
limb (8 out of 14 embryos) 
neural tube (5 out of 14 embryos) 

Embryo 1

Embryo 2

Embryo 3

Embryo 6

Embryo 7

Embryo 10

Fasta sequence
GTCACAAGCGCAGGGTACTTtggtggacacctgagaggcaggaatcctgctcaggaggat
gaggctgcaggacgcccccacagcctgttgtggtcagaccccgaggatccagtgccagct
tgtggtccccctactcgcttactgagaacccagagcctgcccccagggccccgagagcct
ttacgcacagtttaataactagctgtgactgcacacccatgcaagcgctctcccgggcag
gaaatcaaatgtcaccagcactccggaaacagcccttatgaggaaacggcattctggccc
cgggggttttaactgactttacctggtgggccatgtggatcccctcagccgcgcctctcc
tctttacagcctttgcccactgtcctactgggccgtttgtctctttctaactaatttgtg
tcagtaccttctgagctccgttcatgtctgtgagggttagttttctgcgccctcttgacc
aggccttaggacccagttattcaagtgaacactacttaggatgttgtcgtgaaggcattt
tataaatgtgcttaacatcgccaatccatcaactttaactaaaggagatttatcctccat
aacttgggtgggcctggttcagtcagttgaagggtttgagagcaaaactgaggcttcccc
gaggaaggagaaatcccacccgtggactcagcctcagctctggcctgagagtttccagcc
tgacacctgccctggatttcagacttgcctagccagcccccacagttacataagccagtt
ccttgaagtgaatctgtgtgtgcacatgtgcatgtgtgtgtgtgtgcatgtgtgtgtcca
tgtgtgtgtccgtgcatgagtgtgcatgtgtgtatgcatgcatgtgtccgtgtgtgcatc
catgtgtgcatgcacatgtgcatgtgtgtgcatgtgtgtgcacgtgtgcgtgtgtgtgcg
tgtgtgtgcgtgcatgtgtgtgcacgtgtgcgtgtgtgtgcatgcatgtgtgtgcatgtg
tgtgtgcgtgtgtgtgcacgtgtgcgtgtgatctccaactggttctgttcctctggctga
acctggaggatgcatcgtctttctgcattgtctacctgttttacagggacctgccttatc
tttaaaatcagaagtaattaagttcattttaaaagtcaaggcgagtaccaaaaagaatgt
aaacactctattccaaggctgtttcttcctgggacagttgtatttttaacacattttccc
aagagttgctgcagccactctgtgtgagccccgcatcctaccacagccttagggacagca
aggtcaccagctctagaagctctgccttcagaacggcccactctgcagccagccccatga
agacacctcttgggtgcctggtgttgtaaaatttacccaaatccagagccatgattccaa
acctgatggtagaagagcagcattcatttgcttgttcattcattcagcacactcgtattg
ccaagccctgagaataagcgcagggatacggtaataaaccgggagagccaaatcggcccc
atggagtcgagtctaggggaagcaatagacgactaacaaaggaacagtaaacagtctggg
gcaggagcggggggtgtatgattgtgtattgacggtcgtcttcgaggatgggataagggt
gtgatggaatgaaccctgcagatctaaggaaaggccattccagaccctagaggaggtcca
ggaaggaagttcaggagcacaggccacagagggtcactgatttcaccaatttcaccagga
tcagggttttccataccactaaggctggagggacaagggacaggagcgtgaaaggagagg
cgaggctggtgccccaggaaacccaagcctggtctcaggctggtgaagaggtggatgatg
gagcgagtggggaatgagtggtcccagtggccggaaagcttgctgggggctgatctggac
agatgggaggtgggtgaggtcctgggagcggaggttctggagaccggcgggcatggccaa
tgatgagccctaggacgtgactctcacaatggggactgaaggggttggagggaggtgccg
ttggaaaattgcagtaagtgagaagagtcagaaatgggaggaccagagggaaagccactt
ctcagagaagagtaacaggttcaactttggtccaataatcacaatttagagctgacagca
gcttcagaggccatgtgacagataaggaaactaaggccccaaaagcagccgtggagacca
gacccaggggttccggccacggctctgtgccttttgtaaaggcagcctatgtctgcactc
acctgtgctctggcccaggccggccctgcacttcgattgccgggagccctgcacgcggaa
ctgtgtctgcagaagctccttttggcacctgggagggcacctctcatcagtactccagga
cctcggccatcgccacggaccgcagggtgaacgctgggtgggctgtaccatggcctcggc
caccgcctgcagatccaggctccctgcagcctgctgggctggtggcctcaggggaccggt
gagctgcgtctgcctgggctcccgaaaggccgctcccagattttgattttgctttgttac
ctagaacccaggccctctgttgccacaagagggccccccagccccggctcactgaggccc
tccccgtggaggagcgtatcctgtccggtccgcagctcaaatatccagagatcgggagac
cccggccctggccccacccccgccccagctgggccacactgccccctccaccacaccccg
gcaagcccctcctggggctgcactcagtcctgggtgtcagagggtcctctggcttcgctt
gtcacatttaatgacaaatcagaaatcaaatgtatccagagccagcctgggctttaggat
agaaggggagggcaggagtgggggctccggggacaggggctggccgaggagggaggatgg
gggcaagaggatattcgtggggcacccactccccacccatccgccaccccctcctcccag
ggctccttctgaggcctcgctgtccccgccttttagtaaaaagtggagaaacagcctcac
agggtgacctgcttcagctcccaaagccatgctgtggctgaccagggtcaggacccaggt
accaggtccacggctcaggggtgggagccaagcctcactcgactccacgctcagggccgg
gacccaggccacaagcccgacctttgtcctttcctcgagcttgctgggaagcctagactc
acccaaatccaacccaaaaaaggctgcaacaaaccagccttgcttgtgatttcgttttat
gattttcttttcacattttcttactatgggaattctcatgggtacataaaaatagacagc
ttaatatgCACCATATCCCATCCCTCAGcct
Primer
(+)GTCACAAGCGCAGGGTACTT
(+)cacCTGAGGGATGGGATATGGTG


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.