Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs2200 ]


Position: chr7:151,453,949-151,457,105 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: PRKAG2(intragenic)

Timepoints:
e11.5

This element was originally annotated as negative. Upon closer inspection, there is reproducible enhancer activity in the midbrain. The annotation for this element was changed to positive on 11/3/2015.

Expression Pattern
midbrain (mesencephalon) (8 out of 12 embryos) 

Embryo 1

Embryo 6

Embryo 10

Fasta sequence
CGGAGAGTAACCCTCTTCCAggtaggacccgggctgacagctgagctagggccatctgca
ggagacgattcagacggggtcagcgctgcgattcgggggagtaaccagcggtgagcttca
ggcctaaatgctggagtcctaaaattactcgagtctgaccccccggtttttggtcttgct
ctatatttagggacaatggccctattgatgctcactcgctgaaccactgcctggcgtttg
ttctgcggggcaagctggagtggggtgctcctcagccccgggagcccttgggatggaaat
gcaagactcagaggctctaaattaaagtcttaaaagcttgggctcattcctccacacaaa
gcacaaaacctttggcattttatgggaaaacagacttttatttgaaaaataaactcaagt
tgctgggatataaaggaagagctgtctgtgatccaacgctgaaatggtgtgaaaggacct
gaagttttacaagttaaataaacttctctgaaagactcattcgaatttcaaacagctccc
agcacagatcctctgaaaaagatccccagatgcagcaggatgagacacagtgcccgctcc
agggtgggggtcaaccatgtggaatgggagattcggattcaaccacaaacagagaaaatt
aaattccttttggatgttcaaaatacacatgacctcggtcataattgtgagctagtcttg
gaaacggacagggggaaaatctaccattccacatctctggcagaaacccgggacttactt
ccatccagcggatcctctgtgccctaagaaccccccaaaccagactcgcctcaaaggcgt
tccagacgcattctgctgttctctgaccatctagggtggtgttttccaaactgcaaccac
tgcccccgccaccccatcatgaaatcaaccgtgtgggtcagataaagcagctgaaacaat
agaatcgaaaataaagtacctagtcagggtcaatattgcttcgtaaaagggcttttgttg
atgtgttgtatgtgctggattatgccatcagatggatttgttactgtgggctgcagtcaa
aacgttttcaaaccactgctgcgatgaagccctgcggctccgctttaccatctcagtgct
gtaaatcttccccgggtgtcagagtatattctccaccttttgctttgtgcttgtccctac
cagacaccatggtcatcacctagagtagccttcggtgtaatcaaagtaggtggctgtcta
ggccagtgattttcaactcttttttttttttctagtaggacaaagataatgtcccaatgt
ccagcagggctgatcctgtcagtagcagttactgggtgtgccctgctgcccccatcagac
aagatgccatttcttgctccgtgggggccagctggccaaaggccaccttgtctcactccc
taaaagctaccactgcatgattttagggttctgggaagacagtcgcttccaaaaagagaa
tctgtggcatctggttttgatgctaggaattctttctttgttatgagataaatgtgtcaa
ctacccctgaactatgtcacctttaagttctataatgtctattttaaatatttttgccag
aactgtttccatctgagggaggagggaaaaggataaaggcatgttgagctctaggagctg
ggagcccacagaaaggaaaacagagcagggagatccaaggtccccagagacatggtgttc
ttcccatgttgggtgaccatcagtgtaccccaaaggttccaaaccccgaaggcactgata
gacctggggggatgaggaggtatgaactggaagagcttgggaaaataagaggcaagtgca
tgaaaagctcaatatgtgatttttaaagagacaagaaggcaataggaagttatcacgaga
gaacacagactgcaaagagacttaaaataacagctatatttcagggctctggcagattgc
tcaaggcaaacagaatccagtaaggctttctgtagcgggcaagacttgaaggaggtctct
gaggaggcgggagaccatgctaatgtatctccagatccactgcagggacccctcactgct
caccccagccctgtctctaccatctctttactgcacagtagccagacatctctctgcatt
gcatccgatcgacatccgatggctttctgtatcgctcaattaaaacctggaatcctgacc
tctcctgcaaggccccgccccactccctgacctcactccagcacctgctccctccctact
tggttctggccacattgaccagctccctgcaggctcagaggctgctcctgcctccggaca
tttgcatcgtgggcccctccgccaggcgtgccatggcctccacctgtcctctccctggct
ccatctcaccactggccaaatgtctccatgtcagaggctattgctgacttgcccacatag
agcagcacccccgcagcccctctcctttgactgttgttcctcttggcacttgggacacat
gacacttttccacctgtggtaccgattgtccctagaatggtatccccacgagggcaggga
tgggctcattcactgctgcgttcccaagggcccagcacttagcaggttctcatgtaacgt
ggtgcaggtgaatatcctccatgccagacaactcccctttgaaacgcctgggcaggcagg
tatccttgtccgctcctaacaccagctttcttctgtctgggaggcgcatttgaaggtgaa
ccgcactggaaaaaacccaggcaggaacgatacctgctgctttcccccaggcaggaccaa
cctgctcccagcaccagactcagcatgtgaggctatgtcaccccctagtggtcactctgt
cacaaagccagaaaaaccagaggtgggctccgcctggccagctgttctcagggccaaggg
gaccccgacctactctctcacccagactttttctacgagtgaactcagatgtaaacagac
attcagaaaataaaggtgaaaaggcatctaatattgaggccacattgtcttgaatgaggg
agagatttaacatcgacattcttccttctagtacgggctccaggctgagcggctgtccca
agatgtggactgtggtgGGGTAGCACCAAGTCATTCC
Primer
(+)CGGAGAGTAACCCTCTTCCA
(+)GGAATGACTTGGTGCTACCC


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.