Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs2199 ]


Position: chr7:151,450,033-151,453,713 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: PRKAG2(intragenic)

Timepoints:
e11.5

Expression Pattern
midbrain (mesencephalon) (5 out of 6 embryos) 

Embryo 1

Embryo 4

Embryo 5

Fasta sequence
CACTTCACCGGAAAGGTGTCgcggccgcatcgggtgaccctgctgggatgcagaagccca
gggcagcccacggatgggtgggtgcccacctgagggcggaggctggctctgatggtgagg
aaatgtcgaagggcaggtgacacaagaactggccgttgtcctcctgaaaagtgctcaggt
cgtgacagatgagacaggactgaggagctgttccagatgaagagactgaagagaaaggac
aacgaaacaaaacgcgtggctggaggtctcctcttccaagaaatgacgcccctgagacaa
ggcacaaaatgtgaatgaagcctgcagcttagctgatagcatgatatttgtgctgatttc
ctgattttgacaattatactgtggttaggagaatgaccctgtttttatgaaacatccact
gaaatatttaggggtaaagggatatgatgtctgcaaattcctctcaggggttcagaattc
atataaacacacagtgagagatcgtgagaaatgagatatgggcagatctggtgaaatgct
aacatcgggcaatctgggtgaaaaggatatgagaactctttgtattatttttgtgacttt
atgtttgaaattgtcaaaataaaatgttatttattatttaataattgtttttttagagac
agagtctcaccatgttgctcaggctggtctcgaactcctgggctcaagtgatccactacc
ttggcctcccaaagtgctggaattacaagcgtgagccacctcgcccagccctaaagtgtt
attttaaaaaaggaattaagaaatacaggctgagcagtggcttgtgcctatgatcccagc
actttgggaggtcaaggcaggaggatcgcttaagcccaggtgtttgagaccagcctgggc
aacatggcaaaaccccatctctacaaaatatttaaaaattagccgggcatgatggtgcac
acctgtagtcgcagctactcaggaggttggggtaggagaatcgcttgagttgcagtgaac
tgtgatcgcaccactgcactccagcctgagaggcagagcaagaccgcatctcgaaaaaaa
gaaaaagagctacagtgggcctgtgtgttaagtaagagcatgtgttagtgctgcctttta
ctgtctccgaaggtgggagcatcaccaaagcaggccctgagagaactagaggactctaac
tcgctgagggcaaggagattcttccgggaatttttcgttggcttctcccaaataataaca
gcctggacacaggatgtgcaggccagccctggctggggacgtcttccaggctggcgccag
agggcgctgtccccagggaccacacgggatgccaggccacataactctgcaatgtgttgg
ctgaacttttcaggaaacttggatgccgcacatacttttcctttctttgtgggcaggcaa
gatgagtcacgtttttctggagtctgctcagccccagtattcagacctcatcagctgccc
tggtccggaaggctccagctgtggccagtgagcggggggcccagggtgcccgcgttggct
gggccagcactggggcttaggggcagacttgggcaagccagagtcaatcttttttgtcgg
gtacagggtaaagctcacagtaattctggatcatggcaacatctggggacagacccaggg
ccctttgtacaactcacagggcacagccctgagggaggctgggctttggcttcatatagt
ccctgttctcccgcccacccaaccccctccgccgcacctgactccccaccacctctccag
gccctaacttcgagtacctcactctccagcacttcgagctgcacctcactccccagcact
tctccaggccctaccttcgcggtcccctcagttcccctgcctcccttccttccgaaggcc
actgtggtattggaaagttggagcagcgacctgaaggaagggaccccacctgtgtctatc
tgcaggaagggtcgctgcaggctctctgagaggcaggctctgggatggaaatgagcatgt
tggatgtacatcagggagtgctcttgggcctgacaaaggggcgatggagaccccgtgaag
ccccgacagagagttctgaagcccggatgccccttcagagctgtcctgagcgggggtcgg
gggctggtcctttatgtacatcggccggttattgggcgtaggccggctctgggaggggct
gaaggctggcgaggtggtgctccttagctgagggccatctgtctgtcacacccacagctg
ggagtgagttcctcattcttgaaggaatcgggaatctgggaggcacggcacagcacagcc
tcaagggtgttctggctccagggtgttttctagcagagggcctaggggacatgctcagca
tctcagggtgtttcaggcagagggcctaggggacatgagcctgagcagaggaagacaggg
ggtgggtgtgcacaagacacagtcagagccagcccagggtgacctcagaggacctcagag
gccatgtgtggtggggcttggagttttcatttaaatgtgctggggcggcgtcaaggggtt
gaacaggggatgacatgatgggatttatgttttaaaaacaggagttggcaaattactacc
caatggcccaatcctgctggccacctgcttttataaatacttattggaacacagctgcac
cattagtttatactttgtctatggcttcgtagttgcaaaagagaccacgtggccttcgaa
gtctaagacatttaccatctggctttttacaggaaacatttgtcaactgctgtttgaaga
gactcctctccttgctgggcagagtcatttccaaggcagcaaggggactctcacgggggc
cacggcccctcacgagccttcccagtttcaccccggtgcctaaagcaactcactttagca
gttgctcgtgttctttggtattaatgatataaatcacctgtgcacaccatgaggttcctc
caggaggctgcggggccctcccaggtggaagtggagaaaagtcctcagtgtctctacctg
tgcgcaaacacaaatacttccactgccctctcccgcctcctctcccatcccccattggtc
tcctcctcttctcaggcctctccccctggaccaccagtgatgccggcagccacaggtccc
tctgcccccaaagcaggtctcgcctctgcaccatcggtacagtcccacaggcccctgtgg
cctccctgaaagtgaggagtaaaatgactcacgtacaggtcatgtgagcaatgccccagg
aacacacaccacacacgtgactgcaacgaaggaagtgtgggttccttttaacgtaggagc
caccagagcttccccaggaacctctctgcctctgaggcaccaaaggtttcctgtccttgc
aatgctgggagggaccctagatggatttgtgggtgcatctcgggcaccccgctcagcaca
tggctcaggcacacgcaacgactcagtggtgcctccaggcgagcgggtacctgcgctgct
ctcatgctcaatcctcacccctactctgcctggatgcaggggctgacctctgacccctgc
tgccatgtgtccaggctcccgctgggcaggagacagggagacaccttgggcaacatctga
cCATAGCTACAGCCCCTTTGG
Primer
(+)CACTTCACCGGAAAGGTGTC
(+)CCAAAGGGGCTGTAGCTATG


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.