Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs2198 ]


Position: chr7:151,439,778-151,443,512 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: PRKAG2(intragenic)

Timepoints:
e11.5

This sequence did not show observable enhancer activities at E11.5
We define a negative enhancer at this developmental stage when at least 3 transgenics were obtained and yet no reproducible pattern of expression was observed. This does not mean that this sequence is not an enhancer at another time point or a weak enhancer at this time point but below the detectable range at our level of resolution.


Fasta sequence
CCAGACGAGTCAGGAGGCTAcaacaagctgacctgccttgtgggtacaccgtactctgga
agcacaaagccggctgcttcctccccgaggccacttctaggtggctgagcacagaggtgg
ggcacaaaaaactcctcactgctggggtctttctgtttgactcacacatgcctgaaattc
cttacatgagggacaaagctttggatcccacgattagagatgaacgctgatgcgttggga
gagatggcgccttcccattgcagggcaggggctgaggacccttcttcagcatacgtgggc
gggggaaagttgaccactcacaggcggatggggacaccaaaccttcccctcttctgtttc
cgccagtcgatgatcccacatgaatagaggggaaactccctgccacaactgtgaccctgc
tcagagttccttctaacagaatgcttttcacactcagaattcttttttaaagggaggggc
tgaaaaaggaaggaaagaatggctcccaaataggaaccgtattttctaatgtatttttaa
agggccagggcctttttggatcacagtttaaaactcacacccctggctggtgctgcaacc
caaagcctggcacgggaccaggtaattcgggtggcagatgcctttatctcttagcagtgc
cccgtgctgtgtggccaaggcttccaggtcaccattctgacactaggtttataagatctg
ggagggagtgaaatcagagctcagctcattcaacgtgtgttctttacgtgtgtcttctgg
tggctgttcttttagatttctgactacaaacctacctttgacaactcgaaaaagaaaaca
gtgtggaagaatactaccacaaggcatttcatactgttagcatgcttcattgttttctgg
cttttggtttaattttctccccagctagactgaaagctccccgatgacaggtatctcacc
cgcagaagaaagaaaaggagcgattactgagttcctccacgagactcaggagcagcatga
tgggtcagggaacagcaagccagctgctgctccatgctcggcatccctgggagcagcatg
tcctgttcctggaggacgcttttgtggctgttctggagccagggaggctgtgctgactgc
tcctctgccctcggcagggctccaggcttggccagccagggctgggctgcgggaggccat
ggcactaggtcccgttcactctaatacttggattttaccaggtgtgccagcccccccaca
tctggatgctgcaaaacattccacagccagactgtgcactacacagcagagctgggggcg
agagagatgaggaaggagaggtcaggggaactgcagatgggctcgaagatggagcacggt
cacccctgcttcctgcacatgaggataagtggcgtgaaggcgaccacccttccacaagag
acacaatggcgctcctgtggctctgatatgtaacccccacccccagactccggtgaccca
aaacatgcgagtaaaccctttaattgctggaggttctcagccggtgccccggggccacgt
tcccacggcatcggggaagtgccaggacatgtggcacatgttgtcccactaacgtggtgc
tggtccaggctgcaggttggagccccaccccagccttatcgcctggtgaatgggactctg
ggtctccgttgtagacaccatggttggtgcctagcctccacttgtcccccaccccaccac
tgcagtgggcatctgagagccgagggcgtcatcaggccgagctgcctcctactccaggta
gcctgtgaatacctacaggatcaagccccttgaagcccaccctatctctggacttccaat
tatatcaaaaccaaatttttgaaaagaccccaagctttccgtctcatcaaagccactttg
catgttatgtgaagctgcaaatagtctccttgaagctgtcactggggacccatatgagag
aaaagtcactgagactccgtgtaaccaccctccctccatgcgcctccattcattcatgag
actggcacttcccagggcagggctgctgaggcctgggagcaccgcgcaggcagaatcagc
ccggccgaccgagagatccaccagcagagcagggcagggggaaccctagtcacccacacc
ctgcggctgtacagagctgggagactttgcccgcagcagtttcctacattcttctcaacc
atgctgtgtggtagggaggccagccatgactattcagttcaagaaataacatttttcaaa
aacccagaagttcagaggtgctcagtgatttgcccaggatccgtgggcagcttgtgggat
tgtgggggtcgacactggctctgctggttcctcatcagggggccatcaagagccaggctg
cctctgctccatgggtggacggctgcagaagcaggtgaggatgcactactcaaaaacttc
ccgctcatcctgaacctttgcggatcacgaggccatacctgcaaagcacccagtcccctg
cacggctgcgttccaaaccacatctcattatgcaagagggcacgggtcccctccgcgccg
gggagcagcaacacgccttagcacatatttgccagagctctcctgccggttgcaaaatac
tgtgtcatgtttcatggaaagttctaaaggtcactgctgcacttgactctgagatcgcca
cgtcgcctcactggggcctccacgccctgccccaggaggtgtttatgagctggcacctct
gcggagcaccctctgccctgactcaagcccccacgcctctgttccacgtcagcccgacac
actcatggtcatgcacagcctcgtggtgaccacaggaactggagcctgagtctctgagtg
acaagagggtgatttttttggcagagacaaaccacctcagctcacacagctccactcaca
ccagcgatatctaaggccactgagaactggcagaggcaacaggggcatcttgattttaaa
aacacagagaagtactaaaaaggtgaaaaacgatagcaataattatttttagcatgccga
aatgcagcacccaaagagtaagaaatccctggatctccttaaaatctggaaggggcatcg
cattcccccatggagggctcggtggggcccttttcagtcccttctcgtggtgcctggcaa
ccctgcagtcgctcagtgtccaagagcacaccaggccaagagctctgagggctccagcgg
caagaacctgccctgattccagctgctccgtggcgcagaagctgagcgctgggctcaacg
ggggccaccaagcaatggcttctgaaaaccagattctgaaactctgcaggccagccattt
gggttttctgtttaattctctttaagtgatttaattctcttacaagtgctgaagtgagct
gggaatgcaccgaagccttggagaaggacccggttaactcccggactcagcggaaagcca
gtttggcctgtggtctctcacttctaggcgatggggcaggatttccagtgtctggacctg
ggctggtcacagagcaatccacctcctcctgcacgtcactccttaagaagcccctagctt
agattatgagggctgagctgaagtttgcctcagatctctttcttcttatagtgaaatata
tttcaaaacaaggtaacaggtagaaaggtttaaaacacttaggtcagagaacctTAAAGC
AACACAGGTTCACCC
Primer
(+)CCAGACGAGTCAGGAGGCTA
(+)GGGTGAACCTGTGTTGCTTTA


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.