Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Mouse element [ mm2124 ]


Position: chr9:63,627,146-63,631,784 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: Smad3 - Smad6

Timepoints:
e11.5

Expression Pattern
neural tube (3 out of 3 embryos) 
somite (2 out of 3 embryos) 

Embryo 1


Embryo 3


Embryo 4


Fasta sequence
AAGAATGTAGCCCCACAGCCccagagtgtccttgaactctctatgtagccaagacagact
ttgaactcctggtcctcctgtctccatctctcacgtgctggggttacaagtgtgcattgc
catgctcagtttatatggtgctggggattgaactcagggctttgtgtctgctaagcaagc
accctagaagccgagctgcagcccccaccccaccccaccccaccccacccccagagatgg
tgtcctcttatagcaccatttctgactggtggcatacactgctgttgagtgacggggcca
ggcccatgtgccttatttctaccccttgcaagccacgtgcacctaaaggggctccttctc
tgaccttgggcttcttacctgcaagaaaaatggccccttctttgcaatgctgtgaagatg
acatgtggccagttgtcagcatactatgtgtgttcagcaacctttctttatctctgataa
ttcttatcacgacctagtgagaggacagaagagaaacccatgattacctcactagggaaa
ggtgattagggatcccgaagttcaaggttaggtgatgtccaaagtcacatgaagtcccca
aggttgtcccagcccttggcctatagctacttggagtactgactccctctgaagtccctg
tccacttctggagccctggacttggtgtctgagcatgtgcactcacacacacacacctcc
cagtgcacacatgggctgagctgtgtgcaaaggcgaggctgtctgtgtaggtggctggag
ctgtaggcaggcggccaggagtgctccttctgtgtgctttgtgcgctgagagcggcttgc
aggggtgggaagaggtggctgcttggaatagacagaaaagcacagaaggctctccaggca
aaagctcgccccatatgtccttcactgctctgctcagtgctggaaaggcccctctgccct
cggtgaggtcctgcacacacaggcatgctagctgaagcattcttgagcttctccttccgt
tagcctgatccctacccccacgccagcactccctacccacacagagttatttactcccac
tgcaagctcatgctcctcaggaaggatagggaccctctccctaaccccattttcaagtgg
agaccagtccacactgggcatctggacagctgctggcctagactccaagaacagtcccat
ctgcaaggcacacagagccgcttagagtaaaaataacctgtggaatcaattacaacagca
gcagcggcagcagcagcaattagggtgtccgcaggggaatagagacacactgtttaactt
catctccttcctgttccagaagcatgcgggacggtgtgactaagacaaacgcgggttatg
taactggtatttctcatcagaagctgctccatcccatcctccttcaaagaggaagaaaaa
gaggaaggacaagaagatggcctctgacttgcacaagccatggggaagaaaatctagact
tttaacgatagagatcaagctactcctcttgcctcaggcagaacgcttttcagaggagaa
acaagggccttgagtttggtgagctctaaaagactcctggtttttattctacaaataact
ttgactctaagatcctccggggtagcatagggggcttgtttgtgtttgggggaccccact
gttccttagccagggtctgtgtacacaggtggtcattactgtctccctaaaaggaatcca
tttactaatctctcccacgtgagcaggctcagcctttggtcctcatgtcccatccccagg
acgtcgctgggcactgggaggtgaacagctgtggtagaaagaaggctgggtgactttctg
aaaagtgactgagcctctgaggtcaatctagtgttttccattgtcaacagttgctccaag
aacataaaaacgtctgcctctgggatattgtatctccttacttttctcagtgtgtgacaa
aatgcatgtaaaagcaacttaaggagggaggacttcactgaggcccatggtccagtgtta
taagtctctcctggtggaaagacacggtggctggcacttggggcagtttgtcacattgca
tctgcaatcaggaagcagagatgattgcccgtgctcaggtcctaggcatttcttgttatc
tgtctcacgaccacagtccataggatggtggcccccacagttagggtgggtcttcccact
tcaattagctcacctagaaactccctctgggacatggcaagaggtgacatcctagatgat
tctagatgcccatccagttggcaatcagcactaagcatggaggacatccttaaggtgagg
tctggagaagatgaaatacaagttaaacctgagggacatctagaattccaataggtcatc
tgagtaaaagctactctaagctggtatcagacgtgggagggagaaagcctgccaggggga
aggcatttgtgttgggaagcaaaatgtcacacagtactcaataataactacactatctca
gggccacctgaggtaaggtctggaggcccggtgagatccagactggtacaggagaggagg
gtggagtctctcagaaccttctcctaggctaaggggtcagagtcccgacactaaaaaagc
tggagaactgctaacagccctgaaggactaggggcctgaagtcctgggcaggaaaatggc
tcaggtccatcacggaggggacaggattataactcatatcatttcaagacccaagtttac
ttccaggatgtaaagttctgtcacgtggcaggcagatgttgtcaagaccctgccccagct
cagcacatgccccaaacttcccagcatactggccagcagagggccaagcacagtgtgccc
actaatgccctagggattagcccctggccaatgagcagagaagatctgggaggccaacgt
ccaggagagggaaacactgggtgtgcttgggtgtgtcccccagccagatggagccacact
tcccctatggtgacctgatggatgttccatcttcatggcttccttcctacctctgcctca
tccccacctttcaaccccagctcctggggcctcctaaagccgttgcttcagtttgtccct
caccttgggaccaacttctgggaaactcaagctaagagaattaatagacttccctcagga
tatggctggagaaactgaggcccagagagaatatgattgcttttagtcaccaaatagctg
gctaagtcccaggagatagatctcaagtgatcggttccttctcagtgtctccttactttt
ctcagtgtgtgacaaaatgcatgtaaaagcaacttaaggagggaggagttcactgaggcc
catggtccagtgttacaagtctctcgtggtggaaagacagccgattagccaccaagtctg
tcagtgcacagatgattgtggtcccacttttgtttgaacagaaagcaagaggccccagta
aagagcagagtgaggctgaggccccagtgtggttcacactattctgtctccatggtaacg
agggaagtgcccgtttatctgatgtcagcaaaactactgtggcctttgggtccagttgct
ggagttggaatgatatatttgccaaatggagttattagcccttctgaaagaggtgggagg
tgggacttttttttcctcagagaaagagccacggagttcaggggtcactccatgtcaaca
tcacagaagtgcaagatccacagaagtgacttgaaggggccagaggaatatcatgtagac
atagcaacccagaagcgatgttcaaagaacacagccttttaaaagcaagtaaatcttgtc
ctggggaggggtcatctccgaggggcagaggccccgtctctctaaataactcaaggcagc
ttgacatctttgtcaatggacagaacaaaggtactgtgtgctcaggaaaaggatctctct
ctctctctctctctctctctcgtcttttctctgtctctcgtctgtctctctgtttctctg
ttccacccactgtctctctcgttctctttctctctctctgctcctgtctctgtctactgg
gtctatctgtgtctctgtgtctctgtgtgtgtctgtgtctctgtccctctctgtctctgt
ctctgtctctgtctctgtctctctcactcaaaaagacctaactctggagaagtctgagga
accccaagttcagtcacctatgctagggtgtcctcaggaaactactaagtgagaagagct
ggccaactaattgctccgttcctgttctgctttggagtgtttgtaatgagctaactgcag
atccacccatccatccatccatccatccatccatccatccatccatccacccatccaccc
atccatccacccatccatccatccatccacccatccatccatccatccatccatttactc
attcagaaagctcggtatttttattgtcttacttgagaaaaaccatatgtataggacatg
gtaaatgggtgacactcagtggtataaactcacaaaaacaacccagggcaccagcaataa
aagccaagccaaggcaggatcactacggcccatggaaggagtgggaagagttcgtggatC
TGTCCGAGTCCTGTGCTTT
Primer
(+)AAGAATGTAGCCCCACAGCc
(+)AAAGCACAGGACTCGGACAG


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.