Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs2073 ]


Position: chr11:69,054,197-69,056,378 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC338694 - MYEOV

Timepoints:
e11.5

Unidentified reproducible staining in abdominal region.

Expression Pattern
other (6 out of 5 embryos) 

Embryo 1


Embryo 2



Embryo 3

Embryo 4


Fasta sequence
ATCCAGGCTCACTCAACGTCctgctctagagagacctttccctggggagtttgctggccc
tgcctgggtggcatcaggtgcccccctgggcttccccagctcttggcctttgccaccatg
gcccactttgctagcatcaccctctcaggggacaacctcctggcctggctggtggagccc
tgggggcgagccccgtgcccaccctgcttgcgcctccagctccggggcccttctcgagac
tggccctcctggggctcatgccccgcctgctgagcctgctgagagactgccctcagcagg
ccccctccccgatgcccgcgtgcacattcttccttccagaggaatgtcccgggcccaggt
tcccacagaggtgcctgaactgaggggagtgactctctggaccctggcagttgttctgct
gcagaaaaagccattcttttgaactctgctgagtgagctcacaaacagggcataaccgag
acgcgggaatgcctgggtcgccgcgcagtcaccgggcagggccgccctcccctgtgggtc
agcaaaaacggtgtcaagtgaaacccattctaattaaagggaacattaagcaggggcctt
ttaaacatggccatttccgaaagttctctcttgataccaattaattcccagaggaaggag
tggaggcgagggtggggggagggagctgaaagccctgggagagcctagtcccccacctcc
aaatgctcactctgcatttatctagaaatccatctcagcagtcatttaaagaccccagga
aaacttctccaggccctagctcttcaaccgtttaatgaacaatgccccacgccaccaccc
tcccccgacttcctgggaaaagagatgaaaaccagaggggccaaaaacgttgctgcgatg
tgaactggctgagagatggtaccggggaggattggtcaagaggtggctgggtcacataga
tgttcctccgacatcggtggagcgacttttgtgtgccaggtactggcacccacctggtca
gcccaccagggtctgaccctcctctctgccctcttggctgagatagctggaaaactgtag
taactaccaccatgtgcaccatgtacgtcactgtgcttcagatgataaatcatgcaccta
accttgctctgcctccatttctatgtgtgtgtgatagacaaagacagagagaggatgaca
gctgtctcatcctccctttgtgctagttaccacaattttccaactctcttggccaaaagt
agccagagagcagaaaggagggttggactccggtgggcttcacgtaggcttcatgataag
gtgaggtgttcatctaattcagaagagtgattcagaccccaaacaccctgaatccatcag
ttgcctgagcattaaagtgaggattctgcaatcaattagttatgtctgccacgagaacag
catggcacaaccaatacatagcctgtgtgccgggcctgagcaggtgctgctctaaaattg
aaactgaagtggtgtttgaggaaaaattatgaaagcaactggacaaagccattgaacttt
cttatctcaagggcctggagtagcttgtgacatgtcctgagataagaacccacactatcc
ccacccattgcccgggtcacccgatggcctcagacacctgtgaaagctaaacccagacct
gtgaaccacaccctctagctttatggtgccgctcccagcctccagcctctcccttgggcc
ccatgtagctgccggctcactgtctatagtgcacttcagttaagccatcgtctgagtaag
tcttggaagggaccaaagttgggacacgaatcttgtccggaagcaaggtccaggggcttc
tgacccagggaggtgggcatgactcatgctgagcagccgaagctccctgacttgccgtgt
ctgctccggcctctgcatccacctgttgcctctgcctgggctgcttcctcttgcctgcgc
agcctggaaagcttctgctagctctgcagcactgacagcaaagccccccgccctccctgg
cccagctcctccgagctccggcatcgtctcggacagccccatgctttgcactgagaaagc
cccatgctttgcattgagatgtttactgtgttgtaaaccacctgtatgcaaagaatctcT
CTCCTTTGCTCCATTCCTGGgG
Primer
(+)atccaggctcactcaacgtc
(+)caccaggaatggagcaaaggaga


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.