Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs2065 ]


Position: chr10:46,052,882-46,055,670 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: MARCH8 - ZFAND4

Timepoints:
e11.5

Expression Pattern
blood vessels (9 out of 9 embryos) 

Embryo 1

Embryo 2

Embryo 3

Embryo 4

Embryo 5

Embryo 6

Embryo 7

Embryo 8

Fasta sequence
GGTGCTTATTCTTAATACTTCCTACCCattgtctattctatcctacacagacctctagct
accacagctttcaaagtattattttctgacaatatacattgtggatcaccagcacaataa
catcaaatagaaaacaaccagtccttaaagaaaataggaagggtcttaagtctgactgtg
aacagaagaccatacgacctcctgtgcagaggaaatgaagatagggctggaatgtggttt
cagggtcactctaaacggaagtgaggaaccaaaacaggaagaggcaggcccacagctaag
aggaggccacacgggctgcagaaggactcattccatgtctgcatttaacaaaggcttacc
actgcttaggcagccccataacaatgatggaaaggcccctggtaagcacacagactcaca
ggtgccttaggtcaggtacctggggaagcactatgcaagtctcattcaacagacttttag
ttaaatatgcttatgcaggcctgcaaaaaaaatgacttagctataaatttggtaataata
acttagtatattatgtaagaaatgtcaatgatcagtatcagtgaccagtgatcactgata
tttttccatgtgttactatagttctaattatctttggtaatagatgaacgcttagtcaat
cactcctttttcaaaatcattttcatacattattcttcagaagcatgactcctagcctga
gtctgcactgggacaactccaggaaagatagagattttgtacatgactgaggataatagc
agagtcaaggcagacaaggacctgtttaccaaaagcacctagaaatctccagggggcagg
gatcttggggaacggacattcattctacagcaagagttcaggttaatccaaagaaagcca
cagaccatgagaagagagtagtggcttggaggacaacatggtatctgtcattcacactat
cctacataaaagcaagggatgatagtggtattgtgtgatttgttctaagaagaacaatca
aattaaaggcattctcaaaaggctctgaagaacagtaacacttcaaggaatcagcagcac
ggaaagcagcagctgttgccacaggactgacagcagcgtgggtaacaaggaacatcctga
tggccacagccatgacagttgacctatcaaccaaacgatctttgcactgacaacagtggc
tgcacttctggtgccaggcgcacggtggtggctctcagttctgcctccagcactagcagg
ctgtgtgtacatacaaacatacatatgtgtatgtatgtataacacccagctactgacagt
gagaccggagagcatgcggggagaaaatgggagcagaggtacaaaggatctttcacctct
tcaatattaactgttttataattatgtagtaccacaaataaaacttctattttgaataaa
tagaacagaacacattgaggcctaaagggaagaaatatgtagtaaaatcagaaaaaagaa
tttataataaagtcccacttgtgctttgacaattcttgccttttaaaccaagtaatattc
caagtaaatacatctttaaagaaagaaaaggtatagtttaagatgtagtaatttatggca
atttcaattattcaggaggaatatgtattttaggaaaggaatgaataactttagccctgt
catcatctggaaattagaagttggtaaacataccgtaaatctaacctgcctgtatgcttt
tcaccttacggctctgggtaagaatgaatgccataacatatgtgaaaatcacttgcaaac
tatacggtggtatgtacatagatgatagttaagtttctaccatcacaaatgtgctataat
ttttttatctgactttatattacagaacacagtataatgaatttttaagaaatacaatgg
tccctaaggctacttccttcttttttgagacggagtctcactctgttgcccaggctggag
ggcagtggcacaatctcggctcactgcaacctctgcctcccaggttcaagcaattctcct
gcctcagcctcagctgagattacgggcatgcgccaccacgcccagctaatgtttgtattt
tttagtagagacgggatttcattggccatttcttatattactaattcatacacataagaa
tttgttttcatttaattgaagatgctcttatgtatactgatatttaaataaacatgaaca
ttaaatctttgagattaaaacctgtataaatataactggaaacctgcaattccttcttgg
ctagaaacccataaaaaaaattccaagtgtgcattagactcacaatagttttcatacaag
tatgaatggcataaaaatttttaattcaccaaatatatttctgcaactgggtcattcatt
ttctaagttagaggccttttatttttatatcctttgtggcttcaaaaagaattttaaata
ccttgtaagtatacacactaagtatacatcacggcacccttccaagggagcgggcctcgg
cagtgagatttgaacacagaatccttcctccccgcaacacacagacaggcagctgctcca
aggacagccaatctgctggctgggaagaggctaattaggtaagctggcaaattaggcact
aaaagggaggtgaggctgaaagaatatataaaggaagatcctcaaagattcacaagcaaa
gatgaggtgagagggagctgagaaccagaaaaacgagatatgaaatagagaaaagataat
gttgtAGATGAGGAAGCCTTCTGGCtGTa
Primer
(+)ggtgcttattcttaatacttcctaccc
(+)caccgccagaaggcttcctcatct


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.