Mouse element [ mm2 ]Position: chr15:52,166,424-52,166,999 (UCSC browser) Source: Lawrence Berkeley National Laboratory Flanking genes: Slc30a8(intragenic) Timepoints: e11.5 This sequence did not show observable enhancer activities at E11.5 We define a negative enhancer at this developmental stage when at least 3 transgenics were obtained and yet no reproducible pattern of expression was observed. This does not mean that this sequence is not an enhancer at another time point or a weak enhancer at this time point but below the detectable range at our level of resolution. Fasta sequence ttgaGGGCTCTGCCCTTTCTCTATccttcaggtaccaaacccttgaaggtaaaatcggct cctgcttcagcatgtgctcacatgcatgcgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg tgtgtgtgtgtgtatgtgtggagagagagagacagagacagagacagacagagacagaga cagaggcagacagacagagaacatgaatacattatgacattaactgtgttaatcttcctg tggttatcaacagctgccagccaggacagccagtctgtgcggacaggaattgctcaagcc ctcagcagctttgatcttcactctcttaccattcagatagaatctgcagcagaccaggac cccagctgccttctctgcgaagaccctcaggactagctcggtcacactgtcagcttcctg tgtttcctaggccatgataagatgcagcaaagtttctgcaatgcacaatgaggcagccgt cggaatagatttgagaaagtcatgatgatgcaatgtgcacactcttcctttgtatttatc tctatccaccatgaacGAGGATGCATGGGATTTGTCPrimer
|
For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.