Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs187 ]


Position: chr3:71,290,418-71,292,584 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: FOXP1(intragenic)

Timepoints:
e11.5

Expression Pattern
forebrain (8 out of 9 embryos) 

Embryo 1

 
Sections available
Sections available
Embryo 2

Embryo 3

Embryo 4

Embryo 5

Embryo 6

Embryo 7

Fasta sequence
CCATAAGGGAGCACAGGAAAttcactactgctgaaagcaacacaatttgtgaccataaac
tacagaacggtgggggaaaagccatcattttaaataataggtcccaagtctgacttaggg
gcgagtggagagcatttggcgtctcaaattactttaacagggggccctgtcatatcccat
ggaaaggacactccggtctcccctccaccctctaatccttctttcttaaaggaacactca
gcaagataatgaatcctttaaatgttacatcttctgtcgtgcattattgtggtgccgaaa
ctcttcacatcaaacagtcatcaggactattacaaagtgggcttataagagaggggctga
aaaggagctgtgtgaaaagaagtggaaaattaaagctgaagcagtcgaagaaagggctta
atttactggcatgtacagtatgcaaatgagattactctcagcttaactgcatcatttatg
tccataataacggcatcatcattacagggctcaaattaaattacaccataattagcatat
caaagtgattggttaaagtttaaaacaaatacccaattttgttaatgaacagctgtaatt
gtcatgtacacttcagtgaaaactctctaaacaaatatatgttttagaagagaggaagat
ttttttttaagcagacaggtctgtagcagaggtaaattgcctaaaaaaagaatgacatgg
actattctattaatgttaatatatgctgatcattttcaggtaataaaacattctatcaaa
acaaggcttcgcttatatttagacaccttccctgctcttgaaagtgacaaaccaccagaa
acctgcttctacttgcagcaatgataacaatgcaggggtgacctgtctcgaacaagcaaa
ggacatgttcggtaacatgctattactaaccccccatattcatttaaaagacattcgtgt
tcaaatcgtgctgagtcaaagctgatttttttcctcattccagcccaaagagggaagagt
gacagaaaacttgctgcacctatggcatagaccagaacgctcctaagctgatgccctgat
aacatattagacagcctccaactcaatttctcctcatcgaatcatagctacacagcagtt
tgaaacacacagctgcactagggaagtttgctcttccatcattaaaatacatcaggaggt
acagctagctattgtcaattttggctggaatcagcatgcacacaaatttcgtatatgtga
aaccagacactaataataagcttgtttccaaacctttttgttataaccatttaatgtcag
aagagtttctatacaaaaagatttgtcaataatctggaggctcacatgtgaaaaagcttt
ccgcctaagattgtcccatttcttaacaacgtaccccatatgtcctctgagacaactgtg
agggtacatcgctgtgatacacagcatggcaagccaaaatatattttgcccaaaaaggaa
aaaaaaaaaaaaaagcactttcaaatatacttaacaagcaaattgaatgtcttattaaaa
tcgtattatctaaacagtgttcaaaaatttaaagaaagtagcttttcattttattcatcg
aagaatccattaaagcttaggctctgaagtagtatgtaaattatgtgcctttcaaggtag
agctagggcaaattcactccatcaactaatgatgaacctcattatgtgcagggaggattc
ataatgaggaaagagccacccgccattccatgttctaacataaatccctgtaaaatttga
atatctccccgtctaattaaaggctactaattccaatcaccccctccatggccccaaagt
aaaaataaacctctctaaaagcacagactacagttatatttctaaagcagtactcgatcc
tgtttggactcagaaccttccactcagatgtgtttttcgacaagcataattagcagcttt
ctaagatagaaacttaggggctgctcaagctcattttggttaaatacactgaatttctat
ttttcaaagagcttcaccttgacagggctacagtgcatgcacagagatgatccgcagcca
agaaaccaacaggaatgtgcgagcacagtcataacgtaaaataaaatTCTTAGCACTCGA
GTCCCGT
Primer
(+)CCATAAGGGAGCACAGGAAA
(+)ACGGGACTCGAGTGCTAAGA


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.