Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs1690 ]


Position: chr6:111,871,688-111,876,668 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: TRAF3IP2-AS1(intragenic)

Timepoints:
e11.5

Reproducible staining in unidentified abdominal structures.

Expression Pattern
branchial arch (5 out of 7 embryos) 
facial mesenchyme (5 out of 7 embryos) 
forebrain (4 out of 7 embryos) 
heart (4 out of 7 embryos) 
neural tube (5 out of 7 embryos) 
other (5 out of 7 embryos) 
somite (5 out of 7 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Fasta sequence
TTGCTGTGAAAGCTGTGATGTtatcagtgacttctgaggggtgtttattgctatagtaca
tgatctgaaccaatgaagctggacattttaatgtggctgttttgatttgacctgggtgaa
aattagaggtaagcttgcttttacaaacattacttagtgatttttttaaaagctgaatat
ttactagtgcttttcagggtgcttcaaaatattaatattttcatgacaaaaccaccttgt
caaaatgtcagctgtcatttccatcaagatgctggtcctctaacccttcttccctattgt
cctgctaaactggcaacttctaacctaccaagcgttagaaaaacagaaaattgctcttgt
tagaaccatgtatataaagtaagagtaaatgtgatctgggtgagggtctgatggttgtgt
taggaataagagtggggaggtttagtgcctaagccttgggatactgttttggcttggagg
attatcccatgaaacccttttcaccactgatgccgtaggtggaattagctcttcaggcag
acatttttttcttcttagggtcaaaggtaaggtgacatgtgaaggggcagccaaggcatc
atcgggaggctagggcttgatggaaggggtaaggggggtggtgccgggcatctggttgga
gggaagtaggaacacaggcagaagcagagaagggcccttagtgctgccgagcacaggctg
ctgcttgacgcgcagccctcagctggctggccctggctggagaatttctccgcaggtcat
tggttttaccacagtcttgtttggaaaccatctgtgttctaggagcccatggagaacggg
catcttattttgaaaatcagtttgaagctaaagtggactttttaattacaaatgagagca
atgaaaatatagctattgaactttattgttattttggcctcgtaaaaattaaaagtaaac
ttttttaactcaagaggattttataaaatctccccatttgtgtacatttcagacatgaga
ctctaccaccccagaacccatctgagaggaatttaaatctcaggaaagtagcagctttct
tcaagtttctgagtaactgaaccttgtagataacaacagattggaagatagaatcagtta
atccctgaactcaaggaacccttggcccatagcccagacaatacagcatgctgaaaattg
gtctggtcccagcctcacgtaaacctgtttctcctctcctgagaagaatgcagcttttga
ccactgcccagtgtgagagcccggcctcactgttaacacctcagtgaaggcaagaacaag
tggtttgcagtggagggcatcgcctggaaggtggcaaaggccaggcaggtacctgcggcc
cagctgctgctcgacgatgaggctggcagccaagtctagcgccagccttttcaaaagcag
cccttttgataacactgattacatttccctcaccggagccttgggttaattgagcaacag
ccaacttctctgggtaacaaagaggaggggaaagtaatccaaacacaggttttattataa
aaaccagggagtgagagaagtgtgtttattctgtaagataacacacctgctcggtgccgg
ggaggctcatttccatcagttgccatggcaaactcgttatacttcaaggccatgtggctt
tgtttccttttgggatctggtccttgtcctaccttttctaacaactccaacacaatgaca
tggaagcctgcgacagcataattgatttctccttccctctatcaacggttcacatttgtt
cagcacaggactgagtctgccttctcctttgaactccttgctaagcatgaaggcatgctt
cagagagccaccctcattaacattccaggtccctcttccctgtcagcaataaacaagccc
tgcatcaatggcctcctgccttccacttttacaaatgagtggctcagttccatgttttgc
tgctgatccaggtgcccaggcgcatacaacgcgagcctaagaagcacgcgggagggacta
aaaatagaacagcagttttggatgcataccagagcagctacttcatctcaacttgctttg
cacgctaagcctaatgggatccatcaggcatgagttctctcgcgcgctagctccctccct
ctcccctctctccccagctgccgatttccatcagccccttcctggtgaagggagcaaagg
gaggtcaggcaagggacaagaaatgtgtgcccttatggttttcgtttacaagccctggga
gatctgggggctgcagttactccttccataagagagtttctagaaaaaaagcaggcaggc
ccagaacatggtcacctctgcccaggtacactttggtccaagactttcattgtttagcaa
agcctcaaatatcacttcctaatcacccaatacctataacctggacccatgctcctatat
tccttgaaaagttaagtagaaaactaaagtacactgagtgttcctcttacagatcccacc
tgcttgcttgaggctaagaatttgggagcaaatgcacagtgagttggcaacatgtgactg
ccagggtctgcaaaagccacccacctgccgccaagtaccctatccaaaagtgatcctatc
ctaaagcattttccaatagaaaatggaagaagtcatatgcagttaggaacatgctatcct
gcctgggcacaatacctcccagcatgccagctgtgttgactgagcgaggctcctttgtat
gctaaagtgcctcgtgcagcctccctcaaaaggcgagccagcatgaccatacgtttctca
tgtctacatccaaaaggtaatgcagatgttccaaacagctaagtattattccaagaagtg
ccatttttgtggaatcagaattgtgataggacgggctggacgcagtggctcatacccgta
atcccagcactttgggaggctgaggcgggcagatcacttgaggtcaggagttaggagttc
gagaccagcctggccaatgtggtgaaatgcagtctatactaaaaacgcaaaaattagctg
ggcttgtggtgggtgcctgtagtcccagctactaggaaggctgaggcaggagaatcgttt
gaacatgggaggcagaggctgcagtgagctgagatcatggcactattgtactccagcctg
ggcgatagagtgagactgtctcaaaaaaaaaaaaaaaaagaatggtgacaggaagatgaa
tatcacagtatttaaaaatctttttcattgttgatgttttggagattggccagatacaac
taaaagaaactgatctgggccaggtgaggtggctcacgcctgcaatcctagtactttggg
aaaccaaggtgggaggattgtttgagctaggggggtcaagacaagcctgggttgaacata
atgagaccctgtctctacaaaaaaaaaaaaattttttttattttgagacgaagtcctgct
ctgttgcccaggctggagtgcagtagtgctatctctgctcactgcaacctccacctccct
ggctcaagcaattcccctgcctcagcctcccaagtagctggcattacaggcatgtgccac
catgcccagataattttttttgtatttttagtagagacgggatttcactggtctcaaact
cctgacctcaggcaacctgcccaccctggcctcccaaagtgctgggattacaggtgtgag
ccactgtgcccagccaaaatttttaaaaaataaactgggcgtggtggcatgcacctttgg
tcctagctactcaggaggctgaggtggggggatcgcttgagcccgggaggttgaggcttc
agtaagccgtgatcatgccactgcactccagcctgggtggcagagcaagaccatgtctct
aaataaataaataaataagttgatctgactaatagcagattttgtctgtgtcaggcaagt
gtcaagaccttttacattgtgcttcagtttcatataatagcagtataagataaatatgcc
aagccacttcaagaaaagtcatacttcatataatcacagcaataatcaattccccaaaga
atttctaacggaacaagttgcaacatgatcatctaatcctccagtcactagaggatggag
gtacttcttccctcagggagagggaagtatctcttcagggagacaccaggtcatttgttg
aacacatctactgtgaaaaaccagaaagctttctagattcatcaaataaatgtctgcagt
ctggaaatcagaacatccgggttctagtcctaggatgaccttagacaagccacggctgct
ctgggccctgctttccttgtgtataaaacaaagctgcagggatatatgatttctagggtc
tctttctagactgaaagttccataacagaaataaatgatctgagaatttaattgattttc
gtgctttctttcttcctttccccccgacctttggttgttgttgtttatttggttagtagg
ctaaaatagaactatttttcttgaaaaatagtgcataattctctgggatgagaggcattt
cttctctgtggtattttcccacagtgtaaccttccttctcttttcatttgccactaggag
gtgggtctcactgattcttcctggttcattaagaagaaacagaaagatcttgtgttttca
gagactctttctggatcatttcccatgatcataggactttgcaatccatttggcaaaggt
ggtggtgacaatggggtgtttggcaaagtggatgaggtagttgacgaagcagctggggta
aagaaaaatgctcttggcaaaacatcatgaaactagggtggaatgttcaaaatggagaac
ttgcatcccttgctgagatgactccgagaaaaattctgtctttaaagaggtgatttattt
aacaggaaacaaagaaaaaggtatcaacagtaataaTTTTTCTGAGCACTGAGCTGAGaa
a
Primer
(+)TTGCTGTGAAAGCTGTGATGT
(+)CACCTCAGCTCAGTGCTCAGAAAAA


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.