Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs16 ]


Position: chr16:72,980,900-72,982,545 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ZFHX3(intragenic)

Timepoints:
e11.5

The pattern is strongly reproducible. The pattern appears to be in a subset of the neural crest but this is not definitive.

Expression Pattern
mesenchyme derived from neural crest (6 out of 6 embryos) 

Embryo 1

Embryo 3

Embryo 4

Embryo 5

Fasta sequence
GGGCTTCTTGCTATGTCAGCcaatcacggggatcccaagacggtaaatgttaggacgtgg
acatgtgagcattaggggctaggccagagccggccactgtttcaacccaaaagatcccaa
ggatttcaatcaggagcactttgcagaagtaacctgaggcccagagacaaggtaaggggg
cttcccccggatgcctcgggccctgcggcattcccctactccactctacttccaggaggt
gcaaaagaaaaacaggttgaacctaatcctgatttaaacattagtatcacacaaaaatca
aaacgacaccattccaggcaacgaagacaatatcatcaggttttgtagattagcacaacc
ctctctcatttctggattaaaaattatctcacgctttcagaaagttcactcttacagcaa
tctacgcactagcatgcgtgacagcaagggcagtgactccggcccagggtgaggtcagat
gacacaccgaaagccatgccactgcttgaatctcctgagaatgcagctctgtctcctcca
acatgaaaaaggaacaggaggagaataaaagcctcggctgaaagagaggtctgggagggc
caccgggaagccacatacatcactgccacttcactaggtgccgcggagagcagctttgga
gagccgccctggctgatcatgaataatttgccagggaaccgggacagggtggggtgggga
aggggtgaggaaggagggttgtgtgtgagaagcccggtcagctccccgggtcagctgcat
ctggagcggtttctctagcagacagtaaagaactcgattacatccagttaactgtgctct
aaactgattatgcatgtgccgggctaatggattacattagcaagaggaaaaataacatgc
aatcaatctccatttactacaggccacaccagggcctagagaaaaagtgactctcaaacc
acctccaatccccaccccaaatccgtggaatgacgaaaccttgagagggagccttcctta
gtggcaagagaagtttgatcttagtcgtactgagggaccaaagggctgagggcgagcact
ggaatgacaatcccagcggtgtcatccaggagtgagcgggagagctccccgccccctgtg
gcgaagcccgggcaggcacagggccattcattacccaaggactaatgagactagactaat
gacctttggctcctgacggaggcaattctgccctgaacctcaggctggtcactccgggga
tgtgccggccagatgcaccatttcaggatctctccttcaggtgctgggtccacgttctac
cctgcatcccaacgctcaggacccttctacccacgccatctttttgagcaacagtttcct
ctaccttaaaaaaagaaatgagaaaaaagtcccaggatgacaggccagcagtgcagaaac
atgcaaataaacctcgtctcttccaaccacacctcaccctgactctctgggtgtgatccg
tggacacagtttggggaccaaaacaggatgttctcagcaaatccgccgagttccaggccc
gtaagaagcaaagtcaagtgcctgacagactcttattcaagactccagccgcacggagga
tgcagcATGAGAGTTAATCGCCACCG
Primer
(+)GGGCTTCTTGCTATGTCAGC
(+)CGGTGGCGATTAACTCTCAT


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.