Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs1350 ]


Position: chr9:3,401,031-3,402,562 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: RFX3(intragenic)

Timepoints:
e11.5

Expression Pattern
forebrain (6 out of 8 embryos) 
hindbrain (rhombencephalon) (7 out of 8 embryos) 
neural tube (7 out of 8 embryos) 

Embryo 1

Embryo 2

Embryo 4

Embryo 6

Embryo 7

Fasta sequence
GCAATCTTTGGGGTTCTCAAtcgatattacatgatttacacttccaacaacaacagaaag
acatcccctctctctgacaccaaagttaggaagtatttcttctctttcaacagagaccat
aaaacccaactaatacgtatttttccagaggcatttttagtgattaattctgaagacctg
ataaaaacagcagattaattagaatgttaaagcatgtttgaggaatataaccctcccgcc
aaattttgctaaacagatcatttaagcccactgacacattcatagtattctggtaggctt
ccaacatttctgcaaagtaaggatcatcacatgagagcagtgccctagcatgctccattt
taggttttgttttactcccagcataatagcttatgagtatatttgaggtgttcccattca
tccagcagtggtttctggtgttttgtttatgtttgggagtaatttggttagtttagttcc
ttcacagccttctttcaagtgatatttgtttatcagtcacaaatgccgtcacattaatcc
attttgataagctaaataaacccctgcagtttgtcaatgatgcagcccatatgtaaatga
gttgtatattcttacaggagagacatgcacaatttcagtctagtcatcctcgcctaatgt
gtctgtcaggtgtgtcatgagcaacagatgcttgtttgacaaaggacctttttattctgg
ctaattaagcagttggacacacccgcctgttaacggttcttctttgtacagccagctctg
gctgaatcatgcgaatctacagctaaataggccacattttgaaagaaggctaattaaccc
ctacgagaaggaaaagatattgcaaaaacccagatgctgaatggaacaagattagcattt
cttcaacctgatgggtaaaacctaggcaaagcaaatgtgtttggaacaaacatgcattat
tgcaagttttaaggcattcaaatgttttttgtggaacttcctgaagattatttaatacac
tcaaattcacagttggattccttttatcactcacaatgtacatgccagattaaatggatt
aatagtctgacctaatcaattacttatcaaacagaactatgttactgggctagcttaaaa
ataggtagtatccacctaatttttattggggtctttcatcctgaaataatttgctctcct
aaagaccaaagtctgcaaagtttggttccactacacttactgtattatttttaacactga
ggaatgtaacaggtttaaattcagtacagaaaacaaagacctgtaatttaattttcaagc
tcaacagagaatttccttcctttatccttagcatagaaagacaaaaggtgctagttccaa
ttcctacttgaaccgaattaaccaaaattattatgatagttacttaatgggtatagtaaa
aataaacgacatctaaaatgtgaccatattcaagaataacttatttacaagagcattaga
aacctgattCAACATAAGATCACAGAAATGCC
Primer
(+)gcaatctttggggttctcaa
(+)ggcatttctgtgatcttatgttg


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.