Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs1172 ]


Position: chr5:92,634,702-92,636,476 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ARRDC3-AS1 - NR2F1-AS1

Timepoints:
e11.5
e12.5
e13.5

Expression Pattern
eye (9 out of 11 embryos) 
forebrain (9 out of 11 embryos) 

Embryo 1


Embryo 2


 
Sections available
Sections available
Embryo 3


Embryo 4


Embryo 5


Embryo 6


Embryo 8


Embryo 9

Fasta sequence
AAGGTGACCACATTTCTTCCTAAtattctgaataatagttctataaacctgatatctatg
cccagatctagtttcataacactggaattcaaacttagagctgaaatttccatgaagtta
attctatcagcattcagcctcccttagctgtttcaggaattcatcttcgagaaactgtgc
ttttttgtgtgtatttgtcttattaaatccgtgaaactaaaaatgcttgaacaaagtaaa
acattaacaccaactttcacagtaaattattttgtgtgaatgaaagctttttaagagtgt
aagtcttggcataattacccaaaagtagtttagtaaatgccatgaaacattacatctgca
tatcaaaaatgcattctgtatgctacaggaaaattgtagtacggaggcaattttctaata
tttacatatttatagcaagtgcctgtcacaggaaagttaagctcacctgtaaaactttca
tgttacgtaacatgaagaacgtctcatgcttgggtgttctaataaccatgatattatttt
aacaattacactatttaataccttggattagttcctctgatagtgctattagctgtcact
atactcaataataggtgacttcatctttgttatgacatgatctttcctactgtttgttga
cctttcaatacaagggggaggggacgctcccagccccccaaacctttaagcagctactgt
aaagctgcggtttaattctcagctggaatgtttagaaacccttggtgctaaatacctcag
tggactgcttaaacaccaacaacagccttatggggccttacccgaccttaaacacatctt
tttttgttgagaatattgcattctgccacaattctgtgggctaaccctgggctcacatta
aatataccagcttcattgaagcttactgaattgagttgagttgttctttgttttattctc
tctctgcttcaccccccactgggactgggcagcctttcttccagtggagcgtgctttaaa
gtaacccaaagaagaggagggggaacgggggagaaaaaccaaaaggtgcagctaaggccc
gtaattagtcttgatcctccaagtctaaaatattttaacgccaggtttctgattgcagta
tgggcaaagtggatttgggaatgcagaaaagtaattaggtctgtgcattgaagtgtggag
agcatttaaaagtgaatgggtggttactacattcttggcaggctgttttttatcttttca
tgctctgctgttgttagaggtgatgggtttattgcagtttttgcactctggaggtggcta
tgtttttcttaacctagccttttgctctccatctcaaaaatgaatcctcgtggtgtaagg
aagaacaagcgaaatttttaaaaaataaaaacaaggcacattgaccgaatattatgcggt
gaagcagaataagttgggaataaacctcaatgccgcaacaggtcacttataaagattctg
ggtttaattaatgactcactgagcacaggactaacgggagacaatggtcaccccaaggag
aaggaaaacaaaacatggtattctctaaccatgttcacagagccatccaaactatctggg
gggaaagctgacatcattatgtcacttctgggtcctggtatagaagatacaaactataaa
tgtccgagttgtcaaaaatgcatgcttttgattgcttcagtctatagaattgctgcaatt
tgctaagatcacgTCTCTTCAGCCCAGACATTCAT
Primer
(+)AAGGTGACCACATTTCTTCCTAA
(+)ATGAATGTCTGGGCTGAAGAGA


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.