Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs111 ]


Position: chr7:42,191,728-42,193,638 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: GLI3(intragenic)

Timepoints:
e11.5

This element was independently published on in "Paparidis et al. Ultraconserved non-coding sequence elements controls a subset of spatiotemporal GLI3 expression. (2007) Develop. Growth Differ. 49, 543-553."

Expression Pattern
forebrain (4 out of 4 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


 
Sections available
Sections available
Fasta sequence
GGTGATTCCTTCAAGATAAAAACAAaactctgccaggcatcactaactaaggacacctcc
tgtcacctaacaaaattagctgattaggagctcacagtacacgtgttcacccccttttcc
cacttaacattgattttcccttaaaacccattttaatacccactactcctctcttgtccc
aagacctagaagatgcggagtataagagaacagacaatacttacaacacagtccccaggc
tctggctagctactttgcgccaacttctcttggtgagctctctctagctgcgcagaccct
ctaggaacattctcggtatctctctgcctccctctccctctccctctcccaggcaatgct
gctcccattagaggaattaaaagtggttggagccatgctaaatttaacaagctcattagt
attctttctgagtgcttccgagtgaactctccctattcaagcctctctctccagcagaag
ggtcaggcggctaatcattaaatcaaactaatgtcaccctatcacaatcagcctgagaga
aggagggtttattatttcagtttatgctaaataaacggttttacaaatggtccccaagca
aggtcaacagcagcttcaattacaagacaaacttaacaagagttgctataaaccaagtac
tctgtattgacttaagaacaggctccactccacatattgccactagcaggattgtacagg
aatgcatattgtaaaataaaggaaggggtgagcttttttctttgccagaatttgcgagtg
cacagcgactcctcattcacctctctccaaccagctagccgctcagctcaattcacccca
cacaaaggctggagcctagacctcaatggaccgagtgaaacatgttcaaaactaggctct
ctattgtgactgaatttcttaacatcttttcaaaaagcggagaatgccttgaggctaaag
gaagaaacaggctaatggtgaattgggaattctgagcaaatttcagagccctttcctcct
agcttttgaggttgaaagcaagctctttcctttcaagtttcaaagtcctttttcctcccg
cagtgtcacagaaggatttgaaaagaaggtaattgtgctcgcagtctccctgatcagagc
ttacgtcctatttctggtatttcggaatacttcttgcaataatagtgcatatagctcaat
cccttaaccggcctgcactctgcaattgctcattaaatgaacaattgcgggtataaaatg
ccttttatgttcaaggtctggatataagataagcattctaggactctaaatttggtttac
taaggaaactctccatcattaaattacaaaactgaagtcagaatatcaggctttcccaga
aaagtggcactcaggttgcagccagccaaaatgaagggaggatggggcgggcagggagga
ggcaacaaaatgttaagggggggtggggggaaagaccggaggatactcagatttctagcc
aaatgagattctaacaagaaaatactatttccatatttaaggtctgagtttgtgaaacct
tgtaacttctatattgaatgatataataaagtcacgttcaaatgaattaaaatacaggac
tgaggctccataaatatgttgttgactaatctggacccctcacaagcaaacatcttcccc
atccttaagaaaagaaataaccctttcccatcattatttacatcatctcatgtgatcctc
acagcaacccaatgatggcggtaggacaaggtattaggcccagctcagaaactagccgtc
atgtcccaggtgagtaagtgatgcaaagaaacttcccagtatgctttactgaatccacac
ctccctgtcccctgttaacaggacaagagCTCTGTTCCTGGGTAGGCTTTT
Primer
(+)GGTGATTCCTTCAAGATAAAAACAA
(+)AAAAGCCTACCCAGGAACAGAG


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.