Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Mouse element [ mm106 ]


Position: chr15:76,867,070-76,869,194 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: Mb(intragenic)

Timepoints:
e11.5

Expression Pattern
heart (5 out of 6 embryos) 
somite (4 out of 6 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4

Embryo 6

Fasta sequence
ggCCGGGCGAGAAAGTTTGTGAAGtgggttggccaagagtgaggttttaagtagggtggg
agctcactgggggagattttaaacttggagcattttggtgagttaggggcggtcccaggg
ttcgggcaccaatcagatggacagttaagattagtccctgtgactcagaagccaaaaggc
acagtgtgtgagctgtgtggctgccagctacagcctcaggggaatcttggacagggagta
ctgtgtgggagcggggctctgtggcctcccaagaactcagttagggctgtggtagcgctc
tggggcctctttggcagtgtaacatgttctggccggcttcttggtcagcctggagagatc
cctttttctttgcagcccctcctttttaagagggccaggtcacattaacacaggtcctct
cctccctctttgtgtctcagttcattaccacattgaactgaaggatgacgcagaaggttt
aagcctttccacagccctccccatcttaccgaggaggctataaccactcagtgacctgct
tagaggcctccctcctcccctcagctcctccttctctccccttctccctcctcctccccc
tcctcactcctcttccctctcttcctcttcctccttcctcaggagcattcaggtcagagg
atgggaaaaaacagccaataatgaggcagttctggccatttctgcaggccctgtagtttc
ttaagtctctcccagtcatgtggctgtaggccttgatatttcttgatattccacatgcct
tagaacagaaggtgggcctgcttgctggtgtgtaggctaagagaggcagtggctgggcct
gatgcatttctgccttttctccctccaaccctacttgctagcaaacagccccatcgtctt
ctgtctctttcaaggacactgctgttggcttcctgactcacacaagcgccaagatgacct
catctccagagttatttgattttttttttcatcctcagagaatgtttccaaatatggtcc
cattgcaagtcacatggtctcaggctcggctttgtgggggtggggggcgggagggggggt
ggggatggtcattgttcagctgtctacagaagggaaaatgcaggcttggaggagcagaga
tttactgcagatctcggggtctatcggggcagcctagggaagccctgccctggggaggga
ggccaggccagtgtctggattactgtggttccggttctccactctgcaaaagcattcatg
ggaaaaacatctggagctcgggctgcgcaggggagtcccactcccacagtcgctggcagg
tttccctgtctgctggttgagggggaggggtgcagctctcctcaccccctcatgaacaga
ccacagacactcccaagtccctgcctaccaccacagggctgtggggagtggggagagtcc
cggccctgtctttcctgacctctgggtcattgactccctgcacagggtccctgctgtctg
gtgagaagccaggaacccaaggtagaattgaagcaacagctccaaccccacctcctcagc
tctcagaggccacggagcaaagggaattgggtttggcctgcgaacccagccgccagccca
ctctgccttggttctctgagacaggaagaactgactgctccttcttactgacagggtgat
agaccacagagggtcagcctaactccatcccagacacggggccaagtaaacccactccca
gagtctgtttaatggtggtcctgtcttagcccagcctttccttctggtctatttgggggc
tctccagggcacacctgctgaaatgactctagagatcacatgcaaatggcttggtgacca
gcatatggatgctgctggggacaacatgacctttaaaaaatattgttttattatttttag
ttatgtggatgtctatgtgtaggtatatgcatgtcactgcaagtgcccaaaaagacagag
gagttggatgccatagagctggatctacaggcagtgtgaaccacctgacatggttgctgg
gaattgaacttgggcctttggaggaccagttacaggctcttaatatgtgaatcatatctc
cagccCAAAAGGTGATGGGACCTTC
Primer
(+)CACCGGGCGAGAAAGTTTGTGAAG
(+)GAAGGTCCCATCACCTTTTG


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.