Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs1052 ]


Position: chr6:18,536,628-18,538,267 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: RNF144B - MIR548A1

Timepoints:
e11.5

Expression Pattern
branchial arch (7 out of 13 embryos) 
cranial nerve (9 out of 13 embryos) 
forebrain (7 out of 13 embryos) 
other (8 out of 13 embryos) 

Embryo 1




Embryo 2




 
Sections available
Sections available
Embryo 3



Embryo 4



Embryo 5



Embryo 6



Embryo 7


Fasta sequence
TCATAGCCACCCCTCTGAGATAttcttccctctgctgatgtcatgtggtgtggaaaccct
cttctcgtggctgaaaacaatcctaaagaaagtcagcctcatctggggagggggtgcagc
ggggggagaatgggggaatgtccctggccaggaggccggaggtgccccaggaagctgttt
cctctgaatagttaaatggctgcctctcaacttgcacaatgtcacattgaatttgaaaca
gggaactttttatattttttccctgattgtgctggcacctggcagatgcctatttaccac
aggcatcaatacacatagtaatcaaaggaaatcagaggcacagattagcaacagctgcaa
gtcattagtgacagacacgggaaagcacaattctgcacccaactttgaaataaccaatat
gagtatttcagagcacgagggttaccgcagggcactcgctaacatgagagcagccaaaca
atagctgggcttgtctctccagagagcactcttctcaaaggcagcaccacacactccgta
ttataaaccaatcaatcacatgatattggtccactgaacgttagccctttgcagagtcca
tgtgctgatctgatcttctgaccaaaggttgttgaactgaaaaataacctctggctggtg
gaaaactttgttatcgcctgtcataattttagtggtgggagtttgagtgtatttctgatg
acttaattatatgattgacctagttggaaaggggcatatagaggggaaaacaagacattc
ccctttcgcatttaatctcatttttccccaaatttctatttgaaaatcagctatgattga
tagccgttctcttggtagttacatattttcattggcaacactaaccttagcctactccaa
aaaatactattcaatttttagcttttccctaatcaattcattcagtgcctcagtggaata
caagttggtcatttaaaaatttctagctgttgcctgatatgtcccaaaacaaatttagcc
agcatgggtttctattttagaccatctctggaaatgcagatttactgtacaactgggtaa
tggcttagagataaacagacacagtgagccgctgtctgattagcaggactgggcgaaatt
tagcattatatatatactgcaataattggaccattgcaccataggatgtaaagtaaattg
ttctcagtgccatacgtgggctcttcttcttttacttgatactaaggttggattatttca
ttctgttttagaaatttctcctttttccctgctctccctactcaaaaattatcttctgaa
ggtttttctaaaaattcttctaagtaagttgttttggagattaggataagaagggagaaa
atgctgccttttatctggtgcagagccagccattaaatatcagctctttaacaacaagca
aaaagctattattttagaagaaagctgccagagaacatggatcccatagggcatctgcca
catcataggcattcagatgcatgttgtaatagtcatatatgttgtttctttccactgtca
gagtcaacagattattttatacttaactaaataccatgatctcttagtttagggagaTTT
GATTTCTTCAGGTCATTTTG
Primer
(+)TCATAGCCACCCCTCTGAGATA
(+)CAAAATGACCTGAAGAAATCAAA


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.