Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs1011 ]


Position: chr18:76,461,276-76,462,723 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LINC01029 - SALL3

Timepoints:
e11.5

Reproducible but weak staining in two regions of forebrain.

Expression Pattern
forebrain (5 out of 7 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Fasta sequence
TCTCAATCAAGTTTGCCAATCAgcctggataaataatatatgcagaccatatttgggggg
ttttgtctaaggttttcttagagtcttctcctacaaatactctaggtccacagcatttga
ttcagatggaaggaaaaaatgataatctgtaaataatgcttttggtgttgtgaagacaga
acagagtggtgaatgaaaatgagattaagaaagagaagagtagcattctgcaacagcatc
tagtgccattttggcattgcatacttgaatttccagcattaaattgcatcctcttagaag
aatagttcaagccgcagtaaaggcacctgattaatggagcttgaacaacttcaaaaacca
ctgaacaagttctgactatttcttataaagtttcttctctgcaggctgggtaaacagcac
actgtctctttaactgatttattttatttcttttcttttcttttttttttttagtttaaa
gattacatttaatatctatttcccagcagtgtacaaactgacatcatctactcataaaag
cggaatgctttgcttttttaagcttcaagctgaataacaaattgccacagatgacagcat
aaaagaataacagaatggaatcaaaagaaaattcattgtcaacagaaaccccctgctgag
gaatttcaatttcatatatctaattatccctgtcagttggaagaactgacaaaaagcatt
ctttgttctctccttctgcctcccgcatctcactctcaattaattccggcatacaaatat
gactaattgtctttgcagtgctcaagagcgctgtatataaatgttcacgaactgaaaatg
atttggagggtattcatgcaccgatttatgatatttgaacacaatagacatgcataattc
aggtgaccacgttagcaccctcccaagcccgcattacagagattaggcaagattcccttt
cacgtccttttttcatatctgctttgtgacaataactcactttgcacctattaaaagagg
gagcattatatgtctgcggcggctcatcgaaattaccatgaacaagatcatcagcattta
aataacatgtgggcagtgaagagaaggggttggggagggcgcataaaaatatcggggact
ttttaaaagcacagcaagatctctcagaaggttaaagtttgagctttgatttcaggttgt
tggtgtttgggagatttgctttgttttgtttgtttattctgggttttttctctttctttt
tttctttttctttttctttttttttttttttttttggcccctcaagcttgatcaatgttg
acaaaatgcatttcaattaatataactaatgatctccttgtcttcttgtcatcaaaataa
gtaaagatttgtctcaatttaacttcagcaacttgtctttacactATTTGTAGCGGCATC
TAAACAAA
Primer
(+)TCTCAATCAAGTTTGCCAATCA
(+)TTTGTTTAGATGCCGCTACAAAT


For commercial licensing of the VISTA Enhancer Browser and its associated data please contact Virginia de la Puente (vtdelapuente@lbl.gov) at the Berkeley Lab's Innovation and Partnerships Office.